Plot nucleotide diversity with multiple sequence alignment
0
0
Entering edit mode
5 weeks ago
asoundi96 • 0

I have a fasta file containing sequence alignements and i woud like to plot the nucleotide divergence along the sequence positions

I have tried using DNAsp and popgenome in R but it is not really working.

The problem is that i have regions with long gaps in some sequences and i want a tool which do not calculate diversity with sequences containing gaps at a specific position but instead consider other sequences in this region without gaps ?

Can anyone suggest me a tool ? Thanks in advance, and if I missed explaining anything, please let me know!

MSA sequencealignement sequencediversity • 228 views
ADD COMMENT
0
Entering edit mode

Remove the sequences with gaps and feed the rest to sequence logos. or replace the gaps with zeros and feed the MSA to sequence logos. Without example data, and expected output, it would be difficult to address your post.

ADD REPLY
0
Entering edit mode

Thanks for the answer ! I'm actually analysing Tansposable elements which are around 150 bp and some of them have long deletions. Here are is a sample data :

> seq 1

-ggctcgtttggcgcagctccagctcctgattctaagcgaggatctgga---ggagccgtgccaaacgagtattttttt--
aaattgattctcgtgtggagccgaaagatcgggagtcgtttttgtgaagaaaggtgggatct-aaaaaaacctgctccaccctcctttaaaacagctcctcaaccaaccaaatatggacatccccttaaagtttgatc
gaaattactcggaattgccattggacaaaaacataacgagccaatttatggattaaacatttgaggccattttatg
cactactatgatggaaatattttatatgttattgtttcatattttttt--

 > seq 2

---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------tggacctccccttaaagtttgatcgaaattacccgcaattgctattggacaaaaacataacgagccaatttatggattaaaca
tttgagaccattttatgcactactacgatgagaatattttatatgttattgtttcatattttttt--

I would like to get this kind of output to identify regins with low diversity: enter image description here

ADD REPLY

Login before adding your answer.

Traffic: 2521 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6