Trimming an alignment around a given sequence
Entering edit mode
13 months ago
QLFblaireau ▴ 30

Hello, I have a simple question but actually I have troubles finding how to solve it. I have many alignment files. And I want for each of them get rid in the alignment of overhang bases. The twist is that I want this done relatively to a specific sequence, which is always the first of the alignment and is always named "Scaffoldxxxx" (where x are numbers and others). Here is a pic

what needs to be cropped is in the red squares

As you see, I want to trim everything that is upstream and downstream of the start and end of the first sequence. That's easy in a sequence editor such as Jalview. But as I have thousands of alignments, I need to automate it. Surprisingly I don't even know where to start.

Many thanks for any help or insight.

As requested, here is a sample alignment :


I would need to trim this alignment so that its length is the length of the first sequence. I don't want in the second sequence what is upstream and downstream of the bases that match the first sequence.

pairwise script crop alignment • 732 views
Entering edit mode

it would help better to understand the issue if you post the data instead of images.

Entering edit mode

I have updated accordingly.

Entering edit mode

first sequence is not in the second sequence.

Entering edit mode
13 months ago

If you knew how much to trim you can do it with any data trimmer, like cutadapt

figuring out how many to strip at start or end is a little trickier to do in a single command-line solution but it can be done with some scripting:

import sys

stream = sys.stdin

# Skip first sequence name.
line = next(stream)

seq = ''

line = next(sys.stdin)

# Collect the first sequence.
while not line.startswith(">"):
    seq += line.strip()
    line = next(stream)

lcount = len(seq) - len(seq.lstrip("-"))
rcount = len(seq) - len(seq.rstrip("-"))

print (lcount, rcount)

run it with:

cat foo.fa | python 

it prints:

391 422

now use cutadapt like so:

 cutadapt -u 391 -u -422  foo.fa > out.fa


Entering edit mode
13 months ago

It's a two step procedure. Thanks Istvan Albert for making me under stand the query.

$ seqkit head -n 1 test.fa | seqkit locate -Pdip '(N+)' 

seqID   patternName pattern strand  start   end matched
Scaffold_2:57492774-57492872    (N+)    (N+)    +   392 489 cttgagctggggtctggccatggggtaaagaagcagcagcagagacagaccaatgccaatgaggattccatactgcacacagtcacaagcatgggtta

Note down the coordinates: 392-489 here

$ seqkit -w 0 subseq -r 392:489 test.fa


Download seqkit from here

Entering edit mode

thanks a lot, I was thinking seqkit might have the solution but failed to find it. Thanks a lot.


Login before adding your answer.

Traffic: 1248 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6