Exonerate - issues when running it
1
1
Entering edit mode
8 weeks ago
helloword • 0

Hi! I just downloaded Exonerate (the source code) and am trying to run it. The command is as follows:

exonerate tube.drome.protein.fasta calm.human.dna.fasta --showcigar yes

However, I am getting this output on console. (In other words, cannot see cigar string for instance.)

Command line: [exonerate tube.drome.protein.fasta calm.human.dna.fasta --showcigar yes]
Hostname: [beep]
-- completed exonerate analysis

Am I missing something? Thanks in advance.

Edit: I am running this on "exonerate-2.2.0" directory.

Exonerate • 415 views
ADD COMMENT
1
Entering edit mode

It doesn't look you are getting an error. I guess Exonerate is simply not able to map your protein sequences to your reference because there's no match.

ADD REPLY
0
Entering edit mode

ok, i got your point now it works. But I have 1 more question. I am very new to this and my question might sound stupid but I want to try this with 2 alignments, a length of 10 but As, Gs, etc are determined by me. I am doing it just to test (assume aim is simple ungapped alignment). But I think the fast files that I changed are wrong because even if 2 fasta files are the same, the console does not show me the results. How should the fasta files be rearranged? Thank you very much in advance.

ADD REPLY
1
Entering edit mode

Sometimes when we make a toy fasta file we end up unwittingly messing things up, sometimes the file is soo simple ... that it misbehaves as input (maybe it is too short, maybe it is too repetitive etc)

Get a FASTA file that is in Genbank and use that:

efetch -db nuccore -id 2 -format fasta

prints:

>A00002.1 B.taurus DNA sequence 1 from patent application EP0238993
AATTCATGCGTCCGGACTTCTGCCTCGAGCCGCCGTACACTGGGCCCTGCAAAGCTCGTATCATCCGTTA
CTTCTACAATGCAAAGGCAGGCCTGTGTCAGACCTTCGTATACGGCGGTTGCCGTGCTAAGCGTAACAAC
TTCAAATCCGCGGAAGACTGCGAACGTACTTGCGGTGGTCCTTAGTAAAGCTTG
ADD REPLY
1
Entering edit mode
8 weeks ago

get toy data

efetch -db nuccore -id 2 -format fasta > a.fa
efetch -db nuccore -id 2 -format fasta > b.fa

runt the alignment

exonerate a.fa b.fa

prints:

Command line: [exonerate a.fa b.fa]
Hostname: [beep]

C4 Alignment:
------------
         Query: A00002.1 B.taurus DNA sequence 1 from patent application EP0238993
        Target: A00003.1 B.taurus DNA sequence 2 from patent application EP0238993:[revcomp]
         Model: ungapped:dna2dna
     Raw score: 970
   Query range: 0 -> 194
  Target range: 194 -> 0

   1 : AATTCATGCGTCCGGACTTCTGCCTCGAGCCGCCGTACACTGGGCCCTGCAAAGCTCGTATCAT :  64
       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 194 : AATTCATGCGTCCGGACTTCTGCCTCGAGCCGCCGTACACTGGGCCCTGCAAAGCTCGTATCAT : 131

  65 : CCGTTACTTCTACAATGCAAAGGCAGGCCTGTGTCAGACCTTCGTATACGGCGGTTGCCGTGCT : 128
       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 130 : CCGTTACTTCTACAATGCAAAGGCAGGCCTGTGTCAGACCTTCGTATACGGCGGTTGCCGTGCT :  67

 129 : AAGCGTAACAACTTCAAATCCGCGGAAGACTGCGAACGTACTTGCGGTGGTCCTTAGTAAAGCT : 192
       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
  66 : AAGCGTAACAACTTCAAATCCGCGGAAGACTGCGAACGTACTTGCGGTGGTCCTTAGTAAAGCT :   3

 193 : TG : 194
       ||
   2 : TG :   1

vulgar: A00002.1 0 194 + A00003.1 194 0 - 970 M 194 194
-- completed exonerate analysis
ADD COMMENT

Login before adding your answer.

Traffic: 1791 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6