Annovar output no comment column?
0
0
Entering edit mode
12 weeks ago

I have run the Annovar to annotate my GWAS results. My input (a list of rsID) was converted to avinput first by:

convert2annovar.pl -format rsid GWAS_rsID.txt -dbsnpfile ../../humandb/hg19_snp138.txt > snplist.avinput

Then I run the command to annotate:

 annotate_variation.pl -filter -out ex1 -build hg19 -dbtype snp138 snplist.avinput ../../humandb

It was running, but my output didn't include the information I need. The comment column didn't tell any functional or annotated gene information. It only outputs the matched rsID. It is odd. Could someone help?

[user@login PATH]$ head -100 ex1.hg19_snp138_dropped 

snp138  rs201106462 chr1    10329   10352   ACCCCTAACCCTAACCCTAACCCT    -   rs201106462
snp138  rs77366501  chr1    100858  100858  T   C   rs368741663
snp138  rs11584349  chr1    1000156 1000156 C   G   rs11584349
snp138  rs11584349  chr1    1000156 1000156 C   T   rs11584349
snp138  rs9442365   chr1    1000643 1000643 C   G   rs9442365
snp138  rs75316104  chr1    1000760 1000760 G   A   rs7531610
annovar GWAS annotation Annovar Post-GWAS • 130 views
ADD COMMENT

Login before adding your answer.

Traffic: 1997 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6