Remove adpater from reads
0
0
Entering edit mode
2.7 years ago
priya.bmg ▴ 60

Hello

I need advice on adapter trimming. I removed the Ilumina small RNA 3' adapter from my forward sequence and Ilumina Universal adapter from the reverse strand (using cutadapt). Used the adpater information from https://eurofinsgenomics.eu/media/1610545/illumina-adapter-sequences.pdf. But still could see the adapter not being removed as shown below in the fastQC report. Am I using the wrong adapter information or missing any step?

¨Forward adapter

cutadapt -a ATCTCGTATGCCGTCTTCTGCTTG -o output.fastq 24_1.fastq ## remove adapter from forward strand

Reverse adapter

cutadapt -a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -o output2.fastq 24_2.fastq ## remove adapter from reverse strand

Thanks

Priya

trimming adpater cutadapt • 937 views
ADD COMMENT
1
Entering edit mode

It appears that you have very short inserts and cutadapt is not making the initial matches. I am not a cutadapt user but you will need to decrease the initial seed match.

With bbduk.sh from BBMap suite you can try:

bbduk.sh -Xmx4g in=file.fastq out=trimmed.fastq literal=ATCTCGTATGCCGTCTTCTGCTTG,AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT  k=8 ktrim=r
ADD REPLY
0
Entering edit mode

I think you need to reverse complement the adapter in this case. (Just noticed the input is two different files, forward and reverse)

EDIT:

And here more info about the parameters https://cutadapt.readthedocs.io/en/stable/guide.html#adapter-trimming-parameters You may need to change the -e and -O parameter.

ADD REPLY

Login before adding your answer.

Traffic: 1252 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6