How can i get sequences from a big list of accession number from NCBI?
1
0
Entering edit mode
10 weeks ago
Camp • 0

Hi, everyone! I'm new to this world and im getting acquainted to Biopython.. is there a way on biopython to retrieve the sequences from a txt file with several accession numbers?

gene NCBI Biopython • 166 views
ADD COMMENT
0
Entering edit mode
10 weeks ago
GenoMax 108k

Using EntrezDirect. Sequences truncated for brevity. Use appropriate database.

$ more id.txt
NC_021708
NC_019498
NC_019944

$ cat id.txt | epost -db nuccore -format acc | efetch -format fasta 
>NC_021708.1 Cuban alphasatellite 1 complete sequence, isolate 1_1
ACCCCGCCTCGTGCCATCTCTCCGTGCCATTGACTGGTCAATGGCTGTGGGTTTTTAAGGGCGTGCCGTC
--
>NC_019944.1 Okra enation leaf curl alphasatellite, complete sequence
AAGCTTTGGCCCCTGCGCACTTTAACCTTTGGCCCCTATAAATATATTTGTGCTGAGGCCGGATCATAGT
--
>NC_019498.1 Dragonfly-associated alphasatellite isolate PR_NZ48_2009, complete sequence
ACCCGCTTCGTTCCGTTTCCTCCTTGTTCCGGTATTTAAGCCTCCGCTTCTTTCATTTCTGGCTTCCTTT
ADD COMMENT

Login before adding your answer.

Traffic: 2800 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6