Platypus

Question

[McKenna]

Hi,

I'm super new to WGS and bioinformatics, but I'm a classic software data scientist, so I know enough to be annoying.

I'm using Platypus too call variants on 100X WGS via Nebula Genomics. I found an odd series of calls and am not sure if this is noise, or a mutation.

Is this a thing to investigate, or just junk?

Chr: chrX
Position: 67631951-67631955
ID: .
Reference: AGGGG*
Alternate: TGGGT
Qual: 160
Type: MNP
Is Filtered Out: Yes
- alleleBias

Alleles:
Alternate Alleles: TGGGT
Allele Frequency: -1.0

Variant Attributes
PP: 160
MMLQ: 35
TCR: 8
Mapping Quality: 44.97
NR: 0
HP: 4
HapScore: 1
FR: 0.5000
SbPval: 1.0
Source: #
WE: 67631979
TC: 20
SC: TAGGCTGCTCAGGGGTCAGGG
QD: 106.733937431
MGOF: 15
TCF: 12
BRF: 0.11
NF: 2
WS: 67631941
TR: 2

Answer 1

[Jorge Amigo]

In general, an "Is Filtered Out = Yes" message should suggest not to invest too much time on that variant due to its low confidence.

By the way, Octopus is the successor of Platypus, in case you'd like to start working with the latest software avaible.