NGS raw data manipulation using Linux/Unix
1
0
Entering edit mode
26 days ago
rijithraj • 0

Hi,

I wanna add sample ID along with read IDs in my NGS data using unix platform. Can anyone help me with this?

Thanks in advance

Rijith Jayarajan

datamanipulation • 331 views
ADD COMMENT
0
Entering edit mode

add sample ID along with read IDs

Add exactly where? If in fastq header, that would break the Illumina sequence identifier format.

ADD REPLY
0
Entering edit mode

If you go from:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

to:

@SEQ_ID;SAMPLE_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

How would that break the header format?

ADD REPLY
0
Entering edit mode

I meant to say Illumina sequence identifier format. Amended above.

ADD REPLY
0
Entering edit mode

I mostly deal with Ion Torrent reads. Are there any programs that would stop working properly if Illumina read headers were modified by the user?

ADD REPLY
0
Entering edit mode
25 days ago

This is...uncommon. Usually each fastq files name indicates its sample name, or you can add sample ID to the read group info in a bam, but for many applications, again, the sample name can be indicated in the bam name.

ADD COMMENT

Login before adding your answer.

Traffic: 1976 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6