Deleted:How to obtain a protein abundance profile based on a BAM file created using bowtie2 (alignment performed with nucleotide alignment)?
0
0
Entering edit mode
12 months ago
mrj ▴ 100

I have a set of metatranscriptomics sequence samples. Let's say the following sample fastq file is what I have. I would like to map these reads to a bacterial genome assembly identified by the link, https://www.ebi.ac.uk/ena/browser/view/GCA_009849585.1

My objective is to get a count profile of genes/functions mapping to the above genome. I am grateful to you if you can show me the right direction to accomplish this task.

My idea is to use bowtie2 to map any reads to the reference genome and get a bam file. And, then to use featurecounts to get an abundance profile. Am I on correct path or am I missing something?

@K00348:93:HKCH2BBXX:5:1101:26362:1701 1:N:0:NTGAAA
GAAATACGATTGATATGTATTTTCATAACAAAGTATTCTAATGCAATTGTCCTTTTTAATATCATTAAAAAA
+
JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
@K00348:93:HKCH2BBXX:5:1101:26362:1701 2:N:0:NTGAAA
TTTTTTAATGATATTAAAAAGGACAATTGCATTAGAATACTTTGTTATGAAAATACATATCAATCGTATTTC
+
JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
@K00348:93:HKCH2BBXX:5:1101:4422:1842 1:N:0:NTGAAA
CAAGAGTGACGGCAGAGAAATGCCGGACCCGGCCACCCAGCGACACTGGGCAACCCATTCAGGGTTTTGATGGCCAAACTATCCGCCAGC
+
JJJJJJJJFJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJFJJJFJ<JJJ7JJJJJJJFJJJFJJJJJJ
@K00348:93:HKCH2BBXX:5:1101:4422:1842 2:N:0:NTGAAA
ATCGGTCGTCAAGCGACCCAGGGACCCCGGCGTGGCGCGAACAAGCTGGCGTGATCGTTTGGTATGCAGAGCTGGCGGATAGTTTGGCCA
+
JJJJJJJJFJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFJJ7FJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
function metatranscriptomics file bam accession alignment protein • 308 views
ADD COMMENT
This thread is not open. No new answers may be added
Traffic: 594 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6