BLAST Results, location on genome
0
0
Entering edit mode
11 months ago
setschmann ▴ 10

Hi, I'm visualizing a genome, and i have to be able to get from a blast search result to the location of the hit.

So im running a BLAST instance locally, and I already generated a BLAST db. Searching against this db works, but i don't know where the hits are. I would need to know in what fasta file the sequence was found to visualize it in jbrowse.

any ideas?

genome BLAST • 478 views
ADD COMMENT
0
Entering edit mode

but i don't know where the hits are.

Your blast results should include chromosome designation of the hits and their coordinates. What is the specific use case of need to visualize? If you are starting with fastq reads you could look at using magicblast (LINK) which can create BAM files for visualization.

ADD REPLY
0
Entering edit mode

i have a reference genome with a lot of contigs, so the contigs where it was found should be somewhere in the blast results? so heres an example of a result

<Hit>
<Hit_num>1</Hit_num>
<Hit_id>gi|224285507|gb|BT070989.1|</Hit_id>
<Hit_def>Picea sitchensis clone WS02763_M01 unknown mRNA</Hit_def>
<Hit_accession>BT070989</Hit_accession>
<Hit_len>2834</Hit_len>
<Hit_hsps>
<Hsp>
<Hsp_num>1</Hsp_num>
<Hsp_bit-score>1253.15</Hsp_bit-score>
<Hsp_score>678</Hsp_score>
<Hsp_evalue>0</Hsp_evalue>
<Hsp_query-from>2</Hsp_query-from>
<Hsp_query-to>766</Hsp_query-to>
<Hsp_hit-from>1526</Hsp_hit-from>
<Hsp_hit-to>2290</Hsp_hit-to>
<Hsp_query-frame>1</Hsp_query-frame>
<Hsp_hit-frame>1</Hsp_hit-frame>
<Hsp_identity>736</Hsp_identity>
<Hsp_positive>736</Hsp_positive>
<Hsp_gaps>0</Hsp_gaps>
<Hsp_align-len>765</Hsp_align-len>
<Hsp_qseq>AGTGTGGCTGCAATGTATGGGATTGCAGTCGCTGCTTTGGGAATGCTCAGTACCATTGCAACTGGACTTGCGATCGATGCTTATGGTCCTATTAGTGACAATGCTGGCGGTATTGCTGAGATGGCTGGTTTTAGCCATAAGATTCGTGAAAGGACTGATGCTCTAGATGCAGCAGGGAATACTACTGCTGCAATTGGCAAGGGATTTGCCATTGGCTCAGCTGCATTAGTGTCTCTTGCATTATTTGGAGCATTTGTAAGCCGGGCTGCAATTTCAACAGTGGATGTCCTTACACCCAAAGTATTCATTGGTTTAATTGTTGGGGCCATGTTGCCTTACTGGTTTTCAGCTATGACAATGAAAAGTGTGGGAAGTGCAGCATTGAAAATGGTTGAAGAGGTCCGCAGACAGTTCAAAAATATTCCTGGTCTGATGGAAGGAACTGCCAAACCGGACTATGCAACCTGTGTGAAGATATCAACAGATGCCTCGCTTAAAGAAATGATTCCCCCTGGTGCCCTTGTAATGCTCACACCCCTCATTGTTGGTACCTTGTTTGGAGTTGAGACTCTGTCTGGAGTTCTGGCTGGAGCCCTTGTCTCTGGAGTACAGGTTGCAATATCAGCTTCCAACACTGGCGGTGCCTGGGACAATGCCAAGAAATACATAGAGGCAGGGGCATCAAAAGCTGCAAGGGAACTAGGTCCTAAAGGATCTGATGCCCACAAGGCAGCTGTTATCGGTGATACCATAGGGGACCCATTG</Hsp_qseq>
<Hsp_hseq>AGTCTGGCTGCAATGTATGGGATTGCAGTGGCTGCTTTGGGGATGCTCAGTACCATTGCGACTGGACTGGCGATAGATGCTTATGGTCCTATTAGTGACAATGCTGGCGGTATTGCCGAGATGGCTGGCTTTAGCCATAAGATTCGTGAAAGGACCGATGCTCTAGACGCAGCAGGGAATACTACTGCTGCAATTGGCAAGGGCTTTGCCATTGGCTCAGCTGCGTTGGTGTCTCTTGCATTATTTGGAGCATTTGTAAGCCGGGCCGCAATTTCAAAAGTGGATGTCCTTACACCCAAAGTATTCATTGGTTTACTTGTTGGGGCCATGTTGCCTTACTGGTTTTCAGCTATGACAATGAAAAGTGTGGGAAGTGCAGCATTGAAAATGGTTGAAGAGGTCCGCAGACAGTTCAGAGATATTCCTGGTCTGATGGAAGGAACTGCCAAACCGGATTATGCAACCTGTGTGAAGATATCAACAGATGCCTCGCTTAGAGAAATGATTCCTCCCGGTGCCCTTGTAATGCTCACACCCCTCATTGTTGGAACGTTGTTTGGAGTTGAGACTCTGTCTGGAGTTCTGGCTGGAGCCCTTGTCTCAGGAGTACAGGTTGCAATATCAGCTTCCAACACTGGCGGTGCTTGGGACAATGCCAAGAAATACATAGAGGCAGGGGCATCAAAAGCTGCAAGGGAACTTGGTCCTAAAGGATCTGATGCCCACAAGGCTGCTGTTATCGGTGATACCATAGGGGATCCATTG</Hsp_hseq>
<Hsp_midline>||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||</Hsp_midline>
</Hsp>
</Hit_hsps>
</Hit>
ADD REPLY
0
Entering edit mode

If you have a blast "hit" then the hit record should always contain the accession/name of the reference for the subject. Your query may show multiple hits (and multiple HSPs on the same hit as well).

In example above:

<Hit_accession>BT070989</Hit_accession>
ADD REPLY
0
Entering edit mode

okay thank you, now how do cross reference that? is there a way to get the location in the original fasta file i used for creating the db?

Edit: okay I think I forgot to -parse_seqid when generating the db, that's why I can't find anything lol

ADD REPLY

Login before adding your answer.

Traffic: 639 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6