Understanding pilon correction on the reference sequence
0
0
Entering edit mode
7 weeks ago

Hello,

I need some clarification about specific kind fix made by pilon on the reference sequence:

ref             -GGAGTGCTCCGGGCGGGTGACCCGGCACCACCACGACAGCGCCTGCTGCTGTGGACCGA
fix             CGGAGTGCTCCGGGCGGGTGACCCGGCACCACCACGACAGCGCCTGCTGCTGTGGACCGA
                 ***********************************************************

ref             TCAGCTGGTCCGGTTCCCGAAGGTGACTGTCTCGCAGCGTGGTCGCGTCGTCGCGACCAC
fix             TCAGCTGGTCCGGTTCCCGAAGGTGACTGTCTCGCAGCGTGGTCGCGTCGTCGCGACCAC
                ************************************************************

ref             GCTGCTGCCCTGGGCCGCCTCACCGGGACGGGTCTTCCGGGTGCCGTGGTCGATCATGGA
fix             GCTGCTGCCCTGGGCCGCCTCACCGGGACGGGTCTTCCGGGTGCCGTGGTCGATCATGGA
                ************************************************************

ref             CGCCGTCGACCCGGCACTGGGGCCCGTGACCGTCGGACTGGCCAACGCACCTCGTCGGGG
fix             CGCCGTCGACCCGGCACTGGGGCCCGTGACCGTCGGACTGGCCAACGCACCTCGTCGGGG
                ************************************************************

ref             AACCACGCCCAATGCGGTCGGGGAATTCATTCCCTCCCGCTGCAACTGAGCACACCCCCG
fix             AACCACGCCCAATGCGGTCGGGGAATTCATTCCCTCCCGCTGCAACTGAGCACACCCCCG
                ************************************************************

ref             ACACGCACTCTCGTTCAGCACTACCCCGCACACAGATTGTCGACAGTAAACTTCGATCGA
fix             ACACGCACTCTCGTTCAGCACTACCCCGCACACAGATTGTCGACAGTAAACTTCGATCGA
                ************************************************************

ref             TCGGAAGACACATGACGGAAGTACAGGGCGGTTTGCACGGTCCCGAGATGCGGCGGGCCA
fix             TCGGAAGACACATGACGGAAGTACAGGGCGGTTTGCACGGTCCCGAGATGCGGCGGGCCA
                ************************************************************

ref             TCACGGCCGCCGCGATCGGAAACTTCATCACCTGGTTCGACTTCGCGGCATACGGATTTC
fix             TCACGGCCGCCGCGATCGGAAACTTCATCACCTGGTTCGACTTCGCGGCATACGGATTTC
                ************************************************************

ref             TCGCCGTCCTGCTCGGCCAGATCTTCTTT-
fix             TCGCCGTCCTGCTCGGCCAGATCTTCTTTC
                ***************************** 

In the example above ref and fix are identical except the first and last bases. My question is: why is this fix not reported as two independent nucletide insertion? It is possible that what I am looking at is a local misassembly?

Thanks

pilon • 232 views
ADD COMMENT
0
Entering edit mode

It might be that the "fix" is that pilon extended the contig with two bases: a C on either end of the contig.

(technically that would probably not indicated as 'insertion' but rather as 'extension' , I would think)

ADD REPLY
0
Entering edit mode

Thank you for answering lieven.sterck

Those changes actually happen on a scaffold of several Mbp.

I will post the same question on https://github.com/broadinstitute/pilon in case someone has the same doubt.

It is not important, but for some odd reason it really bugs me

ADD REPLY

Login before adding your answer.

Traffic: 2507 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6