Anyone could help me with cutadapt?
0
0
Entering edit mode
6 weeks ago
ALEJANDRO • 0

I', trying to trim my primers off from Illumina sequences. I 've amplified with: Diat_rbcL_F1 AGGTGAAGTAAAAGGTTCWTACTTAAA, Diat_rbcL_F2 AGGTGAAGTTAAAGGTTCWTAYTTAAA and Diat_rbcL_F3 AGGTGAAACTAAAGGTTCWTACTTAAA as Forward primers and Diat_rbcL_R1 5’CCTTCTAATTTACCWACWACTG 3’ (Reverse Complement: 3’CAGTWGTWGGTAAATTAGAAGG 5’) and Diat_rbcL_R2 5’CCTTCTAATTTACCWACAACAG 3’ (Reverse Complement: 3’CTGTTGTWGGTAAATTAGAAGG 5’) Reverse primers. First, I used PEAR to assembly paired reads using default settings. Here, there is a example of a sequence found within assembled fastq file: 5' AGGTGAAGTTAAAGGTTCTTACTTAAACATTACTGCTGCTACAATGGAAGAAGTATACAAACGTGCTGAGTATGCTAAAGCAGTTGGTTCTGTAATTGTTATGATTGACTTAGTAATGGGTTACACAGCAATTCAAAGTTCTGCTATTTGGGCTCGTGAAAACGATATGCTTTTACACTTACACCGTGCTGGTAACTCAACTTACGCTCGTCAAAAAAACCACGGTATTAACTTCCGTGTAATTTGTAAATGGATGCGTATGTCAGGTGTAGACCACATCCACGCAGGTACAGTAGTAGGTAAATTAGAAGG 3'

I followed the instruction of Cutadapt to trim off primers from 5' and 3' end, however adapter 1 and 2 (Reverse primers) are removed seldom: Follow, i provide the coomand used and the output:

cutadapt '/home/alejandro/Documents/S1_merged.assembled.fastq' -a CAGTWGTWGGTAAATTAGAAGG -a CTGTTGTWGGTAAATTAGAAGG 

alejandro@alejandro-MS-7680:~$ cutadapt '/home/alejandro/Documents/S1_merged.assembled.fastq' -a CAGTWGTWGGTAAATTAGAAGG -a CTGTTGTWGGTAAATTAGAAGG -g AGGTGAAGTAAAAGGTTCWTACTTAAA -g AGGTGAAGTTAAAGGTTCWTAYTTAAA -g AGGTGAAACTAAAGGTTCWTACTTAAA > '/home/alejandro/Documents/S1_merged.assembled.trim.fastq'

Output:

This is cutadapt 3.4 with Python 3.8.10
Command line parameters: /home/alejandro/Documents/S1_merged.assembled.fastq -a CAGTWGTWGGTAAATTAGAAGG -a CTGTTGTWGGTAAATTAGAAGG -g AGGTGAAGTAAAAGGTTCWTACTTAAA -g AGGTGAAGTTAAAGGTTCWTAYTTAAA -g AGGTGAAACTAAAGGTTCWTACTTAAA
Processing reads on 1 core in single-end mode ...
[    8=------] 00:00:12       183,003 reads  @     70.4 µs/read;   0.85 M reads/minute
Finished in 12.89 s (70 µs/read; 0.85 M reads/minute).

=== Summary ===

Total reads processed:                 183,003
Reads with adapters:                   182,987 (100.0%)
Reads written (passing filters):       183,003 (100.0%)

Total basepairs processed:    55,639,287 bp
Total written (filtered):     50,698,531 bp (91.1%)

=== Adapter 1 ===

Sequence: CAGTWGTWGGTAAATTAGAAGG; Type: regular 3'; Length: 22; Trimmed: 89 times

No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-22 bp: 2

Bases preceding removed adapters:
  A: 94.4%
  C: 5.6%
  G: 0.0%
  T: 0.0%
  none/other: 0.0%
WARNING:
    The adapter is preceded by "A" extremely often.
    The provided adapter sequence could be incomplete at its 5' end.

Overview of removed sequences
length  count   expect  max.err error counts
21  1   0.0 2   0 1
22  87  0.0 2   70 9 8
23  1   0.0 2   0 1


=== Adapter 2 ===

Sequence: CTGTTGTWGGTAAATTAGAAGG; Type: regular 3'; Length: 22; Trimmed: 140 times

No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-22 bp: 2

Bases preceding removed adapters:
  A: 95.7%
  C: 1.4%
  G: 0.7%
  T: 2.1%
  none/other: 0.0%
WARNING:
    The adapter is preceded by "A" extremely often.
    The provided adapter sequence could be incomplete at its 5' end.

Overview of removed sequences
length  count   expect  max.err error counts
22  140 0.0 2   117 18 5


=== Adapter 3 ===

Sequence: AGGTGAAGTAAAAGGTTCWTACTTAAA; Type: regular 5'; Length: 27; Trimmed: 56780 times

No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-27 bp: 2

Overview of removed sequences
length  count   expect  max.err error counts
24  4   0.0 2   2 2
25  53  0.0 2   4 2 47
26  906 0.0 2   49 815 42
27  55685   0.0 2   54012 1595 78
28  79  0.0 2   8 65 6
29  41  0.0 2   0 0 41
282 2   0.0 2   2
284 2   0.0 2   2
285 1   0.0 2   1
288 1   0.0 2   1
290 5   0.0 2   5
370 1   0.0 2   1


=== Adapter 4 ===

Sequence: AGGTGAAGTTAAAGGTTCWTAYTTAAA; Type: regular 5'; Length: 27; Trimmed: 56267 times

No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-27 bp: 2

Overview of removed sequences
length  count   expect  max.err error counts
23  4   0.0 2   4
24  3   0.0 2   2 1
25  23  0.0 2   6 3 14
26  652 0.0 2   46 580 26
27  55501   0.0 2   52849 2527 125
28  51  0.0 2   5 43 3
29  32  0.0 2   0 0 32
290 1   0.0 2   1


=== Adapter 5 ===

Sequence: AGGTGAAACTAAAGGTTCWTACTTAAA; Type: regular 5'; Length: 27; Trimmed: 69711 times

No. of allowed errors:
1-9 bp: 0; 10-19 bp: 1; 20-27 bp: 2

Overview of removed sequences
length  count   expect  max.err error counts
23  1   0.0 2   0 1
24  2   0.0 2   1 1
25  46  0.0 2   3 5 38
26  855 0.0 2   40 777 38
27  68659   0.0 2   66547 1998 114
28  80  0.0 2   9 70 1
29  68  0.0 2   0 0 68


WARNING:
    One or more of your adapter sequences may be incomplete.
    Please see the detailed output above.

Anyone could help me please?

Best regards

Cutadapt trim primer • 169 views
ADD COMMENT
0
Entering edit mode

Have you actually verified that your adapters are being retained after running cutadapt?

ADD REPLY

Login before adding your answer.

Traffic: 1467 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6