Deleted:STARaligner not recocognizing ":" Illumina Quality Score Encoding resulting in "quality string length is not equal to sequence length"error?
0
0
Entering edit mode
6 weeks ago
simplitia ▴ 70

HI recently I got this fatal error from STARaligner.

EXITING because of FATAL ERROR in reads input: quality string length is not equal to sequence length
@A00269:556:HHTWKDRXY:1:2234:19696:18286
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

however grepping the fastq I realized that the reason is because there were a few position that had ":", according to illiumina that is, is a quality score of 25

https://support.illumina.com/help/BaseSpace_OLH_009008/Content/Source/Informatics/BS/QualityScoreEncoding_swBS.htm

**CCCGGATACAGGTTTCGCCAGTAGAGAAATCACAGTATACTTTGATAGCATCCATAGTGCATCCTTGGTTAGGGTCAATCCAGTAGTAACCACTGCTCCAC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

does anyone know how to resolve this?

rnaseq star • 201 views
ADD COMMENT
This thread is not open. No new answers may be added
Traffic: 2165 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6