Deleted:STARaligner not recocognizing ":" Illumina Quality Score Encoding resulting in "quality string length is not equal to sequence length"error?

Question

[simplitia]

HI recently I got this fatal error from STARaligner.

EXITING because of FATAL ERROR in reads input: quality string length is not equal to sequence length
@A00269:556:HHTWKDRXY:1:2234:19696:18286
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

however grepping the fastq I realized that the reason is because there were a few position that had ":", according to illiumina that is, is a quality score of 25

https://support.illumina.com/help/BaseSpace_OLH_009008/Content/Source/Informatics/BS/QualityScoreEncoding_swBS.htm

**CCCGGATACAGGTTTCGCCAGTAGAGAAATCACAGTATACTTTGATAGCATCCATAGTGCATCCTTGGTTAGGGTCAATCCAGTAGTAACCACTGCTCCAC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

does anyone know how to resolve this?