Header error while converting sam file to bam
1
0
Entering edit mode
9 days ago
MS ▴ 20

Hi,

I am trying to convert sam files to bam file after bowtie aligmnet.

I checked previous posts but still have the same error.

I have miRNA-Seq data.

the codes from the script I used are given below: For alignment:

bowtie -n 2 -l 32 -f --norc --best --strata -m 1 --threads 16 $HUMANMIRBASEINDEX/hsa-index $OUTPUTDIR/$i/$i".min18max30L.fasta" --un $OUTPUTDIR/$i/$i"-maturemiRNA-unalignedReads-bowtie1-beststratam1.fasta" -S $OUTPUTDIR/$i/$i"-maturemiRNA-aligned-bowtie1-beststratam1.sam" 2> $OUTPUTDIR/$i/$i"-bowtie-maturemiRNA-beststratam1.log"

to convert sam file to bam files I tried first:

samtools sort $OUTPUTDIR/$i/$i"-maturemiRNA-aligned-bowtie1-beststratam1.sam" > $OUTPUTDIR/$i/$i"-maturemiRNA-aligned-bowtie1-beststratam1.bam"

secondly I tried index ref file with: samtools faidx ref.fa samtools view -bt ref.fa.fai -o aln.bam aln.sam

And here is the error that I always take:

 [E::sam_hrecs_error] Header line does not have a two character key at line 2659: "@A00821:815:HKYLJDRXY:1:2101:8567:1235        4       *    0       0  TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTC       IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII      XM:i:0"
    samtools view: failed to add PG line to the header
errorconvertsamtobam samtools bowtie samtoolsheadererror • 277 views
ADD COMMENT
0
Entering edit mode

To convert SAM to BAM you have to specify that samtools should output BAM format using the -b flag. Have you tried:

samtools view -b input.sam -o output.bam

You can also convert to bam format coming out of bowtie by piping directly using something like:

bowtie -f -S index input.fasta | samtools view -b -o output.bam -

Get the simplest example to work before building up your complete pipeline.

ADD REPLY
0
Entering edit mode

Hi,

thank you for your answer. Yes I already tried these codes. But my problem is about header of sam file.

Even if I try to write directly bam files, the error is same.

[E::sam_hrecs_error] Header line does not have a two character key at line 2659: "@A00821:815:HKYLJDRXY:1:2101:6533:1031        4       *       0       0  TNAGTGCACTACAGAACTTTGT   IIIIIIIIIIIIIIIIIIIIII  XM:i:0"
samtools view: failed to add PG line to the header 

I also tried to add ID while running bowtie as follow:

bowtie -f index data.fa.gz --un data.fastq  -S  --sam-RG ID:A00821 data-maturemiRNA-aligned-bowtie1.sam

But still having the same header error at different line

[E::sam_hrecs_error] Header line does not have a two character key at line 2660: "@A00821:815:HKYLJDRXY:1:2101:6533:1031        4       *       0       0  TNAGTGCACTACAGAACTTTGT   IIIIIIIIIIIIIIIIIIIIII  XM:i:0"
samtools view: failed to add PG line to the header
ADD REPLY
1
Entering edit mode
7 days ago
aw7 ▴ 60

Read names in SAM are not allowed to have @ symbols in them. In the SAM spec the definition of a read name is

QNAME String [!-?A-~]{1,254}

Your read name of @A00821:815:HKYLJDRXY:1:2101:8567:1235 starts with an @ and samtools is treating it as a malformed part of the header (header entries always start with an @ and a two letter key e.g. @SQ).

You need read names that do not contain (or at least start with) an @.

ADD COMMENT

Login before adding your answer.

Traffic: 2759 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6