Making a FASTA file from a segment of a DNA sequence

Question

[rupjandu]

Hello everyone, I have copied a segment of a known DNA sequence and I want to turn this segment of DNA into a FASTA file in order to BLAST it against a custom made database. I mostly work in the web-based GALAXY tool. Is there any program or site out there that can produce a FASTA file for me? Thank you!

Answer 1

[seidel]

A fasta file is simply a text file with a simple but specific format, consisting of the following: a single header line starting with a ">" character, followed by text of your your choice, such as a sequence identifier, or sequence coordinates, and then the lines following the header are the DNA sequence itself. For example:

>chr2L:250-350
TTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGAGAGTAGTG
CCAACATATTGTGCTAATGAGTGCCTCTCGTTCTCTGTCTTATATTACCG

The length of the sequence lines is unimportant. The main idea is a header line, followed by sequence line(s). Make sure it is a simple text file, ascii characters only (not Microsoft Word, etc.).