Making a FASTA file from a segment of a DNA sequence
1
0
Entering edit mode
6 weeks ago
rupjandu • 0

Hello everyone, I have copied a segment of a known DNA sequence and I want to turn this segment of DNA into a FASTA file in order to BLAST it against a custom made database. I mostly work in the web-based GALAXY tool. Is there any program or site out there that can produce a FASTA file for me? Thank you!

DNA SEQUENCE BLAST FASTA • 221 views
ADD COMMENT
1
Entering edit mode
6 weeks ago
seidel 9.0k

A fasta file is simply a text file with a simple but specific format, consisting of the following: a single header line starting with a ">" character, followed by text of your your choice, such as a sequence identifier, or sequence coordinates, and then the lines following the header are the DNA sequence itself. For example:

>chr2L:250-350
TTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGAGAGTAGTG
CCAACATATTGTGCTAATGAGTGCCTCTCGTTCTCTGTCTTATATTACCG

The length of the sequence lines is unimportant. The main idea is a header line, followed by sequence line(s). Make sure it is a simple text file, ascii characters only (not Microsoft Word, etc.).

ADD COMMENT

Login before adding your answer.

Traffic: 1797 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6