Error in running Splice Site Prediction by Neural Network
0
0
Entering edit mode
4 months ago
Muhammad • 0

Hello everyone

I am trying to run Splice Site Prediction by Neural Network on system, when running online with the fasta it runs fine. Bu When I try to run it on my system it gives following error.

Traceback (most recent call last): File "neural_network_splice.py", line 308, in <module> (training_set, training_targets, test_set, test_targets) = get_preprocessed_data(file_name) File "neural_network_splice.py", line 56, in get_preprocessed_data target_vector = extract_target_values(dataset) File "neural_network_splice.py", line 16, in extract_target_values return [int(value) for value in input_data[::2]] ValueError: invalid literal for int() with base 10: 'ACAGCAGCTCTACCCCTCACGACGCAGACATGGCAGCGCAGAAGGACCAGCAGAAAGATGCCGAGGCGGA'

I am running anaconda environment with python version 2.7.

Thanks in advance guys!!!

site Splice Network Prediction Neural Python Error • 257 views
ADD COMMENT
0
Entering edit mode

Not reproducible. You do not even mention the tool. Probably it needs python3.

ADD REPLY
0
Entering edit mode

Thank you for replying back to me the tools is Splice Site Prediction by Neural Network (Neural Network Splice Algorithm for splice sites prediction). Here is the github link https://github.com/ahryho/neural-network-splice.

ADD REPLY

Login before adding your answer.

Traffic: 1359 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6