Error in running kissplice2reftranscriptome
1
0
Entering edit mode
4 months ago
1012254696 • 0

Dear all ! I've successfully run the KisSplice2RefTranscriptome workflow according to the documentation, I got 30 reads.fq and finish Transdecoder with a reference fasta file (Using Pacbio Seq to sequence and create)like this :

>Gene.103793
ATGTGTGACGACGAGGAAAGCACTGCCCTTGTGTGTGACAATGGATCAGGACTGTGTAAG
GCAGGCTTCGCCGGGGATGATGCTCCCAGAGCGGTGTTCCCCTCCATAGTGGGTCGTCCC
AGACACCAGGGAGTGATGGTGGGAATGGGGCAGAAAGATAGTTATGTTGGCGATGAGGCG
CAAAGCAAAAGGGGAATCCTGACCCTCAAGTACCCTATCGAGCACGGCATCATCACAAAC
TGGGACGACATGGAAAAAATCTGGCATCACTCTTTCTACAATGAGCTCCGTGTGGCTCCA
GAGGAGCACCCCACTCTGCTGACAGAAGCCCCTCTCAATCCCAAAGCCAACAGGGAAAAG
ATGACCCAGATCATGTTTGAGACCTTCAATGTTCCAGCCATGTATGTAGCTATCCAAGCG
GTGCTGTCCCTGTATGCTTCTGGACGTACAACAGGCATTGTCCTCGACTCTGGTGATGGT
GTCACCCACAACGTGCCCATTTATGAGGGCTACGCTCTTCCGCATGCCATTATGCGTTTG
GACTTGGCCGGCCGTGATCTCACTGACTACCTCATGAAGATCCTAACTGAACGAGGCTAC
TCATTCGTCACCACTGCTGAAAGAGAAATTGTCCGAGACATCAAAGAGAAGTTGTGCTAT
GTGGCGCTGGATTTTGAGAATGAGATGGCCACTGCAGCCTCTTCCTCCTCCCTGGAGAAG
AGCTATGAGCTTCCCGATGGACAGGTCATCACCATTGGCAATGAGAGGTTCCGCTGCCCT
GAGACACTCTTCCAGCCATCCTTCATTGGAATGGAATCTGCTGGCATCCATGAAACCACT
TACAACAGCATCATGAAATGCGACATTGATATCCGTAAGGACCTGTATGCCAACAACGTG
TTGTCTGGTGGTACCACCATGTACCCTGGCATTGCAGACAGGATGCAGAAGGAGATCACT
GCTTTGGCCCCCAGCACCATGAAGATCAAGATCATCGCCCCACCTGAGCGCAAGTACTCA
GTATGGATTGGCGGCTCCATCCTGGCCTCCCTCTCCACCTTCCAGCAGATGTGGATAAGC
AAGCAGGAGTATGACGAGGCCGGGCCATCCATTGTGCATCGCAAGTGCTTCTAA

the error occur in this step:

python3 kissplice2reftranscriptome -b NJLFY.transdecoder.cds.fa.bed -k results_coherents_type_2.fa -t type_coherent_2.psl

the problem is:

Opening all files and formatting tables...
Collecting data...
Traceback (most recent call last):
  File "kissplice2reftranscriptome", line 577, in <module>
    main()
  File "kissplice2reftranscriptome", line 443, in main
    blatbd.lowerPath, kSize)
  File "/home/xuweitong/software/kisSplice/kissplice2reftranscriptome-1.3.3/kissplice2reftranscriptomelib/dataAnalysis/snpPositionFinder.py", line 54, in getMultipleSnpPositionInBubbleWithBlat
    if upperRowNucleotide[i] != lowerRowNucleotide[i]:
IndexError: string index out of range

the file results_coherents_type_2.fa is :

>bcc_92143|Cycle_0|Type_2|upper_path_length_91|C1_0|C2_0|C3_0|C4_0|C5_0|C6_0|C7_0|C8_0|C9_2|C10_0|C11_0|C12_0|C13_0|C14_0|C15_0|C16_0|C17_0|C18_0|C19_0|C20_0|C21_0|C22_0|C23_0|C24_0|C25_0|C26_0|C27_0|C28_0|C29_0|C30_0|rank_1.00000
AACTGTATTTTGAAATTCAGAAATAGACAACTTATCACTTGTACAAACTAATCACTTGCACAAACTTATCACTTGTACAAACTTATCACTT
>bcc_92143|Cycle_0|Type_2|lower_path_length_74|C1_1|C2_1|C3_0|C4_0|C5_1|C6_0|C7_0|C8_0|C9_0|C10_0|C11_0|C12_0|C13_0|C14_0|C15_0|C16_0|C17_0|C18_0|C19_0|C20_0|C21_0|C22_0|C23_3|C24_3|C25_0|C26_0|C27_0|C28_0|C29_0|C30_0|rank_1.00000
AACTGTATTTTGAAATTCAGAAATAGACAACTTATCACTTGCACAAACTTATCACTTGTACAAACTTATCACTT

and the file type_coherent_2.psl is :
psLayout version 3

match   mis-    rep.    N's Q gap   Q gap   T gap   T gap   strand  Q           Q       Q       Q   T           T       T       T   block   blockSizes  qStarts  tStarts
        match   match       count   bases   count   bases           name        size    start   end name        size    start   end count
---------------------------------------------------------------------------------------------------------------------------------------------------------------
34  0   0   0   0   0   1   30  +   bcc_75492|Cycle_50|Type_2|upper_path_length_86|C1_0|C2_0|C3_0|C4_0|C5_0|C6_0|C7_0|C8_0|C9_0|C10_0|C11_0|C12_0|C13_0|C14_0|C15_0|C16_0|C17_0|C18_0|C19_0|C20_0|C21_0|C22_0|C23_0|C24_0|C25_4|C26_0|C27_0|C28_0|C29_0|C30_0|rank_1.00000  86  52  86  Gene.94817  1809    1429    1493    2   17,17,  52,69,  1429,1476,
39  0   0   0   0   0   2   71  +   bcc_75492|Cycle_50|Type_2|upper_path_length_86|C1_0|C2_0|C3_0|C4_0|C5_0|C6_0|C7_0|C8_0|C9_0|C10_0|C11_0|C12_0|C13_0|C14_0|C15_0|C16_0|C17_0|C18_0|C19_0|C20_0|C21_0|C22_0|C23_0|C24_0|C25_4|C26_0|C27_0|C28_0|C29_0|C30_0|rank_1.00000  86  35  74  Gene.80066  1245    1085    1195    3   13,12,14,   35,48,60,   1085,1113,1181,

Appreciate for any info! Thanks in advance!

snp kissplice RNA-seq • 211 views
ADD COMMENT
0
Entering edit mode
3 months ago

Dear user,

KisSplice outputs several files. The one for SNPs is "results_coherents_type_0.fa" I think that the bug comes from the fact that you are using "results_coherents_type_2.fa", which corresponds to inexact tandem repeats. KisSplice2RefTranscriptome only handles SNPs.

Best,

Vincent

ADD COMMENT

Login before adding your answer.

Traffic: 2627 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6