How to create a local (custom) database with a multifasta DNA sequence file in Prokka?
0
0
Entering edit mode
8 months ago

Hi everyone, I'm trying to create a local (custom) database for prokka based on a multifasta file that contains a set of DNA sequences of different bacterial genes. It looks like this

>mecI:1:D86934
TTATTTTTTATTCAATATATTTCTCAATTCTTCTATTTCATCTTGTGATAGATCTTCTTTTTCTACAAAGTTTAAGACAAGTGAATTGAAACCGCCTTTGTATACTTTATTGATAAAGTTTTTAGATGTTTTATATTTTATATCACTTTCTTCTACAAGAGAGTAATATTGAAAAATTTTATTGTCTTTTTTACGATTA
>mecI:2:AB037671
TTAAAAAATTTTATTGTCTTTTTTACGATCTATAAATCCCTTTTTATACAATCTCGTTATAAGTGTACGAATGGTTTTTGGACTCCAGTCCTTTTGCATTTGTATTTCTTCTATTATATTATTCGCACTTGCATATTTTTCATCCAAATGATATTCATAACTTCCCATTCTGCAGATGATATTTCATACGTTTTATTATCCAT
>mecI:3:FJ670542
TTATTTTTTATTCAATATATTTCTCAATTCTTCTATTTCATCTTGTGATAGATCTTCTTTTTCTACAAAGTTTAAGACAAGTGAATTGAAACCGCCTTTGTATACTTTATTGATAAAGTTTTTAGATGTTTTATATTTTATATCACTTTCTTCTACAAGAGAGTAATATTGAAAAATTTTATTGTCTTTTTTACGATC
>mecI:4:FJ390057
ATGGATAATAAAACGTATGAAATATCATCTGCAGAATGGGAAGTTATGAATATCATTTGGATGAAAAAATATGCAAGTGCGAATAATATAATAGAAGAAATACAAATGCAAAAGGACTGGAGTCCAAAAACCATTCGTACACTTATAACGAGATTGTATAAAAAGGGATTTATAGATCGTAAAAAAGACAAT........

I´ve been trying to do it converting first, the inicial DNA multifasta file in to a PROTEIN multifasta file by using EMBOSS - transeq tool, then creating a blast database and indexing it in to the PROKKA database directory, and finally do the typing process of this custom database against a bacterial genome in order to get the gbk output of this process. However, I ask you for help if there is an easier way to do this because I'm loosing some sequence information caused by the EMBOSS-transeq process. May be if there is a way to do the setting the DNA database instead of the protein database.

Thank you guys.

database typing process prokka custom • 188 views
ADD COMMENT

Login before adding your answer.

Traffic: 670 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6