Sequence Alignment by Blast issue
Entering edit mode
3 months ago
sara • 0

I'm trying to make sequence alignment using blast, however, it keeps getting this error

Warning: Sequence contains no data Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning:

That's an example of my sample data file:

>SRR12802808.400000 400000 length=2907  TTGGTATGCTTCGTTCAGTTACGTACTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTGCTTAACAAACAAGAAACAAGGGACTCTCTAAAACCAAAGTCTCACTAAGTTTAAAACACCCAAACAGACATATAATATCAGCACCAACAGAAAGCAATACATGCTTGC +SRR12802808.400000 400000 length=2907  %'4*,,-&.0:53496140900.8.1/$,),,.67783/01324664720834541/.7/886///:8011*0-+*+5;7.28;8;1;8/''((61//*%#0*65;42,/866487/:///9::/&07(0-5-.

and aligning it with chromosome 22

Blast Alignment • 328 views
Entering edit mode
3 months ago
GenoMax 115k

You can't use fastq format data for blast searches. You will need to convert this data to fasta format. You can use from BBMap suite or seqtk fasta for this conversion.

Entering edit mode

What is the differance between the two formats ?

Entering edit mode

Fasta format is simply as follows (> followed by identifier then sequence on second line):

>SRR12802808.400000 400000 length=2907  

Fastq format includes a per base quality score (see more in Wiki article). There are 4 lines per sequence record.

@SRR12802808.400000 400000 length=2907  
+SRR12802808.400000 400000 length=2907 
Entering edit mode

I got it now, thank you !


Login before adding your answer.

Traffic: 2345 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6