Tools to visualize 2D RNA Heterodimer
0
0
Entering edit mode
3 months ago
nhaus ▴ 200

Hello,

I am currently predicting RNA structures using RNAcofold.

I was wondering if any of you know a tool (preferably in R) which can be used to visualize 2D RNA structures. I have tried out different programs (e.g. RRNA) and they all work perfectly fine if you only have one dot bracket notation, but as soon as you have two, separated by a &, the programs fail.

This is for example one dot bracket notation that I would like to visualize:

ACGAUCAGAGAUCAGAGCAUACGACAGCAG&ACGAAAAAAAGAGCAUACGACAGCAG

..((((...))))...((...((...((..&............))...))...))..

The sequences before and after the & are the 2 sequences which form the heterodimer.

Any tips are greatly appreciated!

visualization RNA • 109 views
ADD COMMENT

Login before adding your answer.

Traffic: 2693 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6