Question

trimming adapter sequences

0

Entering edit mode

23 months ago

biology_inform ▴ 50

enter image description here Hi all, I have dataset from GEO database and I dont know the adapter sequences which were used. When I run fastqc I get results which I attached as image. I cannot find the adaptor sequences how can i find it ? platform illumina nextseq 500

adapter fastqc rnaseq • 486 views

ADD COMMENT • link updated 23 months ago by Istvan Albert 100k • written 23 months ago by biology_inform ▴ 50

score 1 · Answer 1 · 2022-05-05

1

Entering edit mode

23 months ago

Istvan Albert 100k

It is the Illumina Universal Adapter

use the following sequence

>adapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

ADD COMMENT • link 23 months ago by Istvan Albert 100k