trimming adapter sequences
1
0
Entering edit mode
8 weeks ago
edus_bioinfo ▴ 20

enter image description hereHi all, I have dataset from GEO database and I dont know the adapter sequences which were used. When I run fastqc I get results which I attached as image. I cannot find the adaptor sequences how can i find it ? platform illumina nextseq 500

adapter fastqc rnaseq • 164 views
ADD COMMENT
1
Entering edit mode
8 weeks ago

It is the Illumina Universal Adapter

use the following sequence

>adapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
ADD COMMENT

Login before adding your answer.

Traffic: 1776 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6