convert BGI stLFR reads to 10x format

Question

[y.sevellec]

Hi,

I'm working on stLFR reads and would like to test cloudspades and other assembly tools on them. Most of thoses tools use 10x format for barcoded reads. do anyone have a script to convert barcode splitted stLFR reads into 10x like reads?

thank you in advance!

[GenoMax]

What do you mean by 10x format?

[y.sevellec]

bascally as much as I understand BGI and 10x use different format in the read header for the barcode information:

BGI stLFR look like:

@V100002302L1C001R017000000#0_0_0/1 0   1
TGTCTTCCTGGACAGCTGACATCCCTTTTGTTTTTCTGTTTGCTCAGATGCTGTCTCTTATACACATCTTAGGAAGACAAGCACTGACGACATGATCACC
+
FFFFFFFGFGFFGFDFGFFFFFFFFFFFGFFF@FFFFFFFFFFFF@FFFFFFFFFGGFFEFEFFFF?FFFFGFFFGFFFFFFFGFFEFGFGGFGFFFGFF

were #0_0_0 is the barcode information

and 10x will look like something like:

@V100002302L1C001R017000000 BX:Z:CAGGTATCAGCGTAAG-1
TGTCTTCCTGGACAGCTGACATCCCTTTTGTTTTTCTGTTTGCTCAGATGCTGTCTCTTATACACATCTTAGGAAGACAAGCACTGACGACATGATCACC
+
FFFFFFFGFGFFGFDFGFFFFFFFFFFFGFFF@FFFFFFFFFFFF@FFFFFFFFFGGFFEFEFFFF?FFFFGFFFGFFFFFFFGFFEFGFGGFGFFFGFF

[GenoMax]

Not familiar with stFLR reads but if #0_0_0 is a real barcode (which does not seem to be sequence based) then I am not sure how you can convert that to something like BX:Z:CAGGTATCAGCGTAAG-1.

Had you seen this: https://github.com/BGI-Qingdao/stlfr2supernova_pipeline

Sounds like this is what you are trying to do?