Cellranger count pipestance failed: The read lengths are incompatible with all the chemistries
1
0
Entering edit mode
7 months ago
firestar ★ 1.5k

Hi,

I have been given some FastQ files from Illumina MiSeq containing 10X single-cell gene expression data. When I run CellRanger, I get the following error:

Log message:
The read lengths are incompatible with all the chemistries for Sample GEX083 in "/crex/proj/snic2022-22-123/nobackup/roy/tonsil/data/raw/Fastq".
- read1 median length = 28
- read2 median length = 0
- index1 median length = 0

The minimum read length for different chemistries are:
SC5P-R2 - read1: 26, read2: 25, index1: 0
SC5P-PE - read1: 81, read2: 25, index1: 0
SC3Pv1 - read1: 25, read2: 10, index1: 14
SC3Pv2 - read1: 26, read2: 25, index1: 0
SC3Pv3 - read1: 26, read2: 15, index1: 0
SC3Pv3LT - read1: 26, read2: 25, index1: 0

We expect that at least 50% of the reads exceed the minimum length.

Any ideas on what might be wrong?


More details

I have the following files at data/raw/Fastq/:

FastqSummaryF1L1.txt
FastqSummaryF1L3.txt
FastqSummaryF1L2.txt
FastqSummaryF1L4.txt
GEX083_S1_L001_R1_001.fastq.gz
GEX083_S1_L003_R1_001.fastq.gz
GEX083_S1_L002_R1_001.fastq.gz

Heads of the three fastq files are shown here:

zcat GEX083_S1_L001_R1_001.fastq.gz | head

@NB501805:156:HCW2WBGXK:1:11101:8290:1042 1:N:0:1
TCCCANGCATACAGCTTCGCGCCGTTGT
+
AAAAA#EEEEEEEEEEEEEEEEEEEEEE
@NB501805:156:HCW2WBGXK:1:11101:3197:1042 1:N:0:1
AGCTCNAGTCTCTCCACGGACGCGATAT
+
AAAAA#EEEEEEEEEEEEEEEEEEEEEE
@NB501805:156:HCW2WBGXK:1:11101:19026:1042 1:N:0:1
ATGGGNGCACGCCACATGGCAGGCCCGC


zcat GEX083_S1_L002_R1_001.fastq.gz | head

@NB501805:156:HCW2WBGXK:2:11101:18093:1042 1:N:0:1
CTGATCCCAGGTGTTTATGTGGCCNTCC
+
AAAAAEEEEEEEEEEEEEEEEEEE#EEA
@NB501805:156:HCW2WBGXK:2:11101:2744:1042 1:N:0:1
GTCCTCACATTGCCGGAGTTGAGCNGGA
+
AAAAAEEEEEEEEEEEEEEEE/EE#EEE
@NB501805:156:HCW2WBGXK:2:11101:5237:1042 1:N:0:1
ATAGGCTAGCATTGAAGCCCCTAGNCAG


zcat GEX083_S1_L003_R1_001.fastq.gz | head

@NB501805:156:HCW2WBGXK:3:11401:25091:1021 1:N:0:1
AAANCCACATGGCTATTTTTCATCCTGT
+
AAA#AEEEEAAEEEEEEEEEE/EE/EAE
@NB501805:156:HCW2WBGXK:3:11401:5497:1021 1:N:0:1
TTGNCTGCAGTTGTCACCATGCCCGGCT
+
AAA#AEEEEEEEEEEEEEEEEEEEEEEE
@NB501805:156:HCW2WBGXK:3:11401:21897:1021 1:N:0:1
AGTAGCTTCTGCCCTAAATGTAGAATAT

And I am running cellranger count as follows:

module load bioinfo-tools
module load cellranger/6.0.2

id="GEX083"
path="data/raw/Fastq/"
transcriptome="${CELLRANGER_DATA}/refdata-gex-GRCh38-2020-A/"

cellranger count \
--nosecondary \
--id $id \
--transcriptome=${transcriptome} \
--fastqs $path \
--sample $id \
--localcores 20 \
--localmem 128

Full run log is given below:

Martian Runtime - v4.0.4
2022-06-21 22:00:43 [jobmngr] WARNING: User-supplied amount 128 GB is higher than the detected cgroup memory limit of 123.1 GB
2022-06-21 22:00:43 [jobmngr] WARNING: configured to use 128GB of local memory, but only 105.2GB is currently available.
2022-06-21 22:00:43 [jobmngr] WARNING: detected a cgroup soft memory limit of 123.1GB. If the system runs low on memory, jobs may get killed.
Serving UI at http://r409.uppmax.uu.se:42792?auth=dhbMqhur8mSlD8So2y5KzeKhrnjTIhbmYJn81H9OcAY

Running preflight checks (please wait)...
Checking sample info...
Checking FASTQ folder...
Checking reference...
Checking reference_path (/crex/data/Chromium/cellranger-data/2020-A/refdata-gex-GRCh38-2020-A) on r409.uppmax.uu.se...
Checking optional arguments...
mrc: v4.0.4

mrp: v4.0.4

Anaconda: Python 3.7.6

numpy: 1.19.2

scipy: 1.1.0

pysam: 0.16.0.1

h5py: 2.8.0

pandas: 0.24.2

STAR: 2.7.2a

samtools: samtools 1.10
Using htslib 1.10.2
Copyright (C) 2019 Genome Research Ltd.

2022-06-21 22:00:51 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_CHEMISTRY_DETECTOR._GEM_WELL_CHEMISTRY_DETECTOR.DETECT_COUNT_CHEMISTRY
2022-06-21 22:00:51 [runtime] (run:local) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_CHEMISTRY_DETECTOR._GEM_WELL_CHEMISTRY_DETECTOR.DETECT_COUNT_CHEMISTRY.fork0.chnk0.main
2022-06-21 22:00:51 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.WRITE_GENE_INDEX
2022-06-21 22:00:51 [runtime] (run:local) ID.GEX083.SC_RNA_COUNTER_CS.WRITE_GENE_INDEX.fork0.chnk0.main
2022-06-21 22:00:51 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.SANITIZE_MAP_CALLS
2022-06-21 22:00:51 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.COUNT_GEM_WELL_PROCESSOR._BASIC_SC_RNA_COUNTER.DISABLE_BAMS
2022-06-21 22:00:51 [runtime] (run:local) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.COUNT_GEM_WELL_PROCESSOR._BASIC_SC_RNA_COUNTER.DISABLE_BAMS.fork0.chnk0.main
2022-06-21 22:00:51 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MAKE_FULL_CONFIG._MAKE_VDJ_CONFIG
2022-06-21 22:00:51 [runtime] (run:local) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MAKE_FULL_CONFIG._MAKE_VDJ_CONFIG.fork0.chnk0.main
2022-06-21 22:00:51 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.FULL_COUNT_INPUTS.WRITE_GENE_INDEX
2022-06-21 22:00:51 [runtime] (run:local) ID.GEX083.SC_RNA_COUNTER_CS.FULL_COUNT_INPUTS.WRITE_GENE_INDEX.fork0.chnk0.main
2022-06-21 22:00:52 [runtime] (chunks_complete) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MAKE_FULL_CONFIG._MAKE_VDJ_CONFIG
2022-06-21 22:00:52 [runtime] (chunks_complete) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.COUNT_GEM_WELL_PROCESSOR._BASIC_SC_RNA_COUNTER.DISABLE_BAMS
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_T_GEM_WELL_PROCESSOR.MULTI_SETUP_CHUNKS
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.MULTI_SETUP_CHUNKS
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_T_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.MAKE_SHARD
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.MAKE_SHARD
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_T_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.BARCODE_CORRECTION
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.BARCODE_CORRECTION
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_T_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.RUST_BRIDGE
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_T_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.RUST_BRIDGE
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.ASSEMBLE_VDJ
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_T_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.MERGE_METRICS
2022-06-21 22:00:52 [runtime] (ready) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_GEM_WELL_PROCESSOR.VDJ_B_GEM_WELL_PROCESSOR.SC_VDJ_CONTIG_ASSEMBLER.MERGE_METRICS
2022-06-21 22:00:53 [runtime] (failed) ID.GEX083.SC_RNA_COUNTER_CS.SC_MULTI_CORE.MULTI_CHEMISTRY_DETECTOR._GEM_WELL_CHEMISTRY_DETECTOR.DETECT_COUNT_CHEMISTRY

[error] Pipestance failed. Error log at:
GEX083/SC_RNA_COUNTER_CS/SC_MULTI_CORE/MULTI_CHEMISTRY_DETECTOR/_GEM_WELL_CHEMISTRY_DETECTOR/DETECT_COUNT_CHEMISTRY/fork0/chnk0-u7fb5b22373/_errors

Log message:
The read lengths are incompatible with all the chemistries for Sample GEX083 in "/crex/proj/snic2022-22-123/nobackup/roy/tonsil/data/raw/Fastq".
- read1 median length = 28
- read2 median length = 0
- index1 median length = 0

The minimum read length for different chemistries are:
SC5P-R2 - read1: 26, read2: 25, index1: 0
SC5P-PE - read1: 81, read2: 25, index1: 0
SC3Pv1 - read1: 25, read2: 10, index1: 14
SC3Pv2 - read1: 26, read2: 25, index1: 0
SC3Pv3 - read1: 26, read2: 15, index1: 0
SC3Pv3LT - read1: 26, read2: 25, index1: 0

We expect that at least 50% of the reads exceed the minimum length.


Waiting 6 seconds for UI to do final refresh.
Pipestance failed. Use --noexit option to keep UI running after failure.
10x cellranger single-cell • 1.2k views
ADD COMMENT
0
Entering edit mode

Hi, it seems you only have one of the reads (read 1) coming from different lanes of the sequencer (thus the L001-L003), do you have any other files?

ADD REPLY
0
Entering edit mode

These are all the file I have received from a colleague. I was also wondering if some files were missing, but assumed it was perhaps just single-end reads. I could ask again to double check.

ADD REPLY
0
Entering edit mode

I also encountered the same problem, is single-end sequencing unable to analyze?

ADD REPLY
0
Entering edit mode

hi, have you solved this problem? I have the same problem. Excuse me, what is the problem and how to solve it? and, How did you solve it at last? thanks!

ADD REPLY
0
Entering edit mode

The problem is described in my comments, OP had single-end reads which makes no sense. 10x Chromium is a paired-end sequencing. For more help please open a new question with details on what commands you run and what the errors are.

ADD REPLY
0
Entering edit mode
5 months ago
ATpoint 68k

Yes, as in any 10x R1 contains UMI+CB and R2 the cDNA. Single-end makes no sense.

ADD COMMENT
0
Entering edit mode

To elaborate further on this answer. R1 file examples shown in the original post are 26 bp UMI+Cell barcode reads. R2 files is where you will find the actual cDNA (~50 bp) read. There may also be a I1 file for the Illumina index sequences. This file is optional and may not always be there.

So if you just get a R1 or R2 file that data is not usable at all.

ADD REPLY

Login before adding your answer.

Traffic: 2047 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6