Extract sequence from Fasta using header
2
0
Entering edit mode
7 weeks ago
Princy ▴ 40

Hello, I have a list of headers, I need to extract the sequence from the fasta file. how can I do it? kindly let me know.

The header file looks like this

>TRINITY_DN74691_c0_g1_i1
>TRINITY_DN74659_c0_g1_i1
>TRINITY_DN74659_c0_g1_i1
>TRINITY_DN74698_c0_g1_i1

fasta file looks like this

>TRINITY_DN74697_c0_g1_i1 len=243 path=[221:0-242] [-1, 221, -2]
GTATGTCCCACCAGACACAGCAGGGCTGGCAGGCCGAGTTTGAGTTTGGAATATATCTG
Fasta • 300 views
ADD COMMENT
0
Entering edit mode

@princy: You have asked many questions on biostars over the last few months but appear not to have validated any of them. Accepting answers (you can accept multiple) using the green checkmark is appropriate way to provide closure to threads.

ADD REPLY
1
Entering edit mode
ADD COMMENT
1
Entering edit mode
7 weeks ago

seqkit will be able to do this. (subprogram seq )

(alternative, if you have a blastdb of that fasta file, you can also get them by using blastdbcmd)

ADD COMMENT

Login before adding your answer.

Traffic: 1844 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6