Online and remote blastn producing different results

Question

[e]

Using the following blastn command with the metameta_16S.amplicons.fasta file and the nt database located at /nfs1/CGRB/BlastDB/NCBI/latest_blast_DB/nt: 

blastn -query metameta_16S.amplicons.fasta -task megablast -db /nfs1/CGRB/BlastDB/NCBI/latest_blast_DB/nt -out metameta_16S.ntdb.blastn.redux.txt -evalue 100

I get the following result for 846 entries:

***** No hits found *****

I have used the default evalue (10) and evalues of 1, 100, and 1000, and the results are always the same.

Using blastn in the browser, if I query a fasta entry like the following one that didn't produce a hit using the above blastn command:

>NC_000857.1_Ceratitis.capitata
AAGACGAGAAGACCCTATAAATCTTTATATTTATAATTATTCAAGTTTTTTGGATTAATTTTATTTTTATAATTGTAAATATTTTGTTGGGGTGATGTTAAAATTTAATGAACTTTTAATTATTTATTAAATCATTAATTTATGAATAATTGATCCATTATTAGTGATTATAAGATTAAGTTACTTT

I get many hits.

I need to use command line blastn because of the size of my query. Using command line blastn, how do I get the same hits that I see using the browser?

I should add that another fasta with the following, slightly longer sequence for the same record does produce hits using the above blastn command:

>NC_000857.1_Ceratitis.capitata
AAAGACGAGAAGACCCTATAAATCTTTATATTTATAATTATTCAAGTTTTTTGGATTAATTTTATTTTTATAATTGTAAATATTTTGTTGGGGTGATGTTAAAATTTAATGAACTTTTAATTATTTATTAAATCATTAATTTATGAATAATTGATCCATTATTAGTGATTATAAGATTAAGTTACTTTAGGGATAACAGCGTAATTTTTTTTGAGAGTTCATATCGACAAAAAAGTTTGC

Many thanks!

Answer 1

[Mensur Dlakic]

Been discussed many times. If you search for this topic, there should be many potential explanations.

Briefly: your database version is different from the online version, and likely older. Don't know if -task megablast is default for online version, but you may want to try -task blastn. In general, the differences are either in program or database versions, or in the exact command you are using compared to online.