How to create a fasta file using a list of DNA sequences data
Entering edit mode
7 weeks ago
Alex S ▴ 20

I have a file with the following structure:

Lcn.Chr1:75500000-95000000:1393900-1393947  gaaatgatttaattagattatttgaggtttgatgattaggattagag 1648480
Lcn.Chr1:75500000-95000000:1393980-1394025  AAATATGAACTCAGGGTTTTGAGATAAGCCAAACAACGATTCCAC   1648480
Lcn.Chr1:75500000-95000000:1394080-1394127  caccccaacttttataattgctatttaaattaattaattagtattgt 1648480

I've extracted the sequences using cut -f 2, now I need to make them as a .fasta format to use it as a database for a blast analysis. Any tips on how to add the fasta header to those sequences? The IDs could be numbers 001, 002, 003..

linux fasta • 255 views
Entering edit mode
7 weeks ago
Dave Carlson ★ 1.0k

Using your example file (let's call it seqs.txt).

cat seqs.txt| while read line; do printf "%s%s\n%s\n" ">" $(echo $line | cut -d " " -f 1) $(echo $line | cut -d " " -f 2); done



That's a pretty ugly solution, but it should work.

Entering edit mode
7 weeks ago
Shred ▴ 870

In Python3

import sys

with open(sys.argv[1], 'r') as sequences:
    for idx,line in enumerate(sequences):

Launch it as

python3 your_input_file > output.fasta

It produces


Login before adding your answer.

Traffic: 834 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6