How do I download BAM file from (GIGA)DB?
1
0
Entering edit mode
6 weeks ago
tf • 0

Hello Everyone, I am trying to download some BAM files from GIGA(DB). http://gigadb.org/dataset/view/id/100355/File_page/14 However, I am not being able to download it. Whenever I try, it shows network error after some moments. I would like to know if there is some solution to this. Thank you.

BAMfile • 155 views
ADD COMMENT
0
Entering edit mode
6 weeks ago

it works on my side. Talk to your sysadmin (proxy settings...)

$ wget -q -O - "https://ftp.cngb.org/pub/gigadb/pub/10.5524/100001_101000/100355/transcript-alignments/LowAltitude_cattle_lung_2.bam" | samtools view | head
HWI-ST1307:161:C3UG9ACXX:4:2112:15873:27236 163 1   1044    50  100M    =   1097    153 CTCCAACAACATAGGAACATAGCCCTGAACATTAAAATACAGGCTGCCCAACGTCATGTCAAACCCATAGATGCCCCAAAACTCACTCCTGGACACTTCA    CCCFFFFFHHHHHJIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJGHIHIJIJJJIIIJJJHHHHHFFFFFDDDEDDDDDDDDDDDDDDDDDDDD    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:100    YT:Z:UU NH:i:1  XS:A:+
HWI-ST1307:161:C3UG9ACXX:4:2112:15873:27236 83  1   1097    50  100M    =   1044    -153    TCATGTCAAACCCATAGATGCCCCAAAACTCACTCCTGGACACTTCATTGCACTCCAGAGAGAAGAGATCCAGTTCCACTGACCAGAACACAGATGCAAG    CDDCCA???>DDEDEEEEFFFHFHDGG@FCF=HEJIJIIGF?JIIJJIHIHIJGJIIJJJJIIJIIJJJJIJJIGJIHJJJIJJJJIHHHHHFFFFFCCC    AS:i:-6 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:79C20  YT:Z:UU NH:i:1  XS:A:+
HWI-ST1307:161:C3UG9ACXX:4:2212:15874:29325 163 1   1685    3   100M    =   1781    196 GGAAAAAGAAGAAAGAATTAAAACAAATGAGGACAACCTCAGAGGCCTCTGCGACAATGTTAAATGCCCCAACATTTGAATCATAGGAGTCTCAGCAGAA    BC@FFFFFFHHHHJJIIIIJJJJJJIGGIJJJJJIJJJJJIIJIIJJIIIHIIIIJIGGHHHHGDHDEFFDDDDDDFEDDDDDDDDDDDCDDDEDDDDDD    AS:i:-11    XN:i:0  XM:i:2  XO:i:0  XG:i:0  NM:i:2  MD:Z:6C12G80    YT:Z:UU NH:i:2  CC:Z:7  CP:i:42372672   XS:A:+  HI:i:0
HWI-ST1307:161:C3UG9ACXX:4:2212:15874:29325 83  1   1781    3   100M    =   1685    -196    AGAAGACAACAAAAAGAAAGGGCATGAGAAAATACCTGAGGAGATAATAGTTGAAATTTTCTCTAAAATGGGGAAGGAAATAGCCACCAAAGCCCAAGAA    DDDDDDDDEDEEFFFFFFHHHHHJIJJIIJIGHFJIIIIJJJJJJJJGIIJJJIJIIJJJJJIJJJJIIJJJJJJJJJJIHJJHFEJGGHHGFFFFFCCC    AS:i:-5 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:7G92   YT:Z:UU NH:i:2  CC:Z:7  CP:i:42372576   XS:A:+  HI:i:0
HWI-ST1307:161:C3UG9ACXX:4:2301:3428:46249  163 1   3328    50  100M    =   3378    150 GAAAAAGAAACAAAGGAGGCTATAGCAAAAATCAACAAAACTAACAGCTGGTTCTTTGAGAAGATAAATAAAATAGACAAACCATTAGCCAGACTCATCA    CCCFFFFFHHHHHJJIJJJJJJIJJJIJJJJJIIIJJIJJJJJIJJJJIJHIIJJJJJIJJJJIIJHHHHHHFFFFFFDEEDDDDCDDDDDDDDDDDCDD    AS:i:-5 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:9G90   YT:Z:UU NH:i:1  XS:A:+
HWI-ST1307:161:C3UG9ACXX:4:1108:18449:7446  163 1   3331    50  100M    =   3424    193 AAAGAAACAAAGGAGGCTATAGCAAAAATCAACAAAACTAACAGCTGGTTCTTTGAGAAGATAAATAAAATAGACAAACCATTAGCCAGACTCATCAAGA    CCCFFFFFHHHHGIJJIGIGGHIIJIJJJJIJJJGIJJJJJJJGGIJJGIFGIJJIIIIJGJJJJJJJJHHHHHHFFEFDDEEEEDDDDBDDDDDDDCDC    AS:i:-5 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:6G93   YT:Z:UU NH:i:1  XS:A:+
HWI-ST1307:161:C3UG9ACXX:4:2301:3428:46249  83  1   3378    50  100M    =   3328    -150    GTTCTTTGAGAAGATAAATAAAATAGACAAACCATTAGCCAGACTCATCAAGAAAAAAAGGAGAAAATCAAATCAACAAAATTAGAAATGAAAATGGAGA    DDDDDCA@CCFC@D@FFD@FFFEECFHFIHEJGHCGJJIIHGHGIIHEJJJJJJIJJJJIJJJJJIHCJJJIHJJHJJJJIHGJJIJHFHHHFFFFFCCC    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:100    YT:Z:UU NH:i:1  XS:A:+
ADD COMMENT

Login before adding your answer.

Traffic: 1109 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6