grep sequence larger than read length in fastq
2
0
Entering edit mode
12 weeks ago
Omurice ▴ 10

Apologies for the naive question, if the length of each read in my fastq file is 75bp

For example something like this:

@HS25_123:4:1567:891011:23248/2
CTCCGACAGACTGAGTCGCCCGGGGGGATCTCGAGCGGCCGCCACTGTGCTGGATAATTCGAGCTCGCCCCGACG
+
CCBCCGGGGGGGGGGGGGGGFGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG

is it possible to grep search for a sequence longer than 75bp?

I would assume not, but just wanted to make sure.

Thank you!

RNA-sequencing sequence grep • 297 views
ADD COMMENT
1
Entering edit mode

if the length of each read in my fastq file is 75bp

If that is true/known then as @Mensur said you will not get any results since no read in your will will be longer then 75 bp.

If you want to test if that statement is true, then use @shenwei's code to get an answer.

is it possible to grep search for a sequence longer than 75bp?

You will want to use a tool that understands fastq format rather than grep.

ADD REPLY
1
Entering edit mode
12 weeks ago
Mensur Dlakic ★ 21k

It is possible to search but you won't get any results.

ADD COMMENT
1
Entering edit mode
12 weeks ago

Counting sequences >= 76 bp with seqkit seq.

seqkit seq -m 76 reads_1.fq.gz | seqkit stats
ADD COMMENT

Login before adding your answer.

Traffic: 1814 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6