GSNAP error: Paired-end accessions do not match
0
0
Entering edit mode
3 months ago
Joshua ▴ 10

Hi,

This is my first time using GSNAP aligner. When I tried to align paired end fastq file (which contains only mitochondrial sequence) using GSNAP, I got the following error. Could anyone please guide me how I can resolve this issue.enter image description here

Here are the specific reads that are causing this error.

Read1

@SRR6435655.2790253
TCTAGACCCTACCCCCAACTCCCTCCCATTAATTAGCCTTCTCTTAGCAGCAGCAGGAAAGTCAGCTCAATTCGGCCTCCATCCCTGACTCCCATCTGCCATAGAAGGCCCAGCCCCAGTCTCAGCCCTACTCCACTCCAGCACTATAGTT
+
BAA@CCB@@BB9@@@@BBBBC?@BC@@BBABBBABCB@BACBCB@BCBBCBBCBBCABCBC@CBCBCDBCCBD@AC@CCACCDAACDCCCDAACCDCDCABCCDCCDACAAC=CAAABDBCDDCDCAACCCDDACCCCACDCCCCBAAB@A

Read2

@SRR6435655.1510133
TTACTCTGCAGCCTTTCCAGGGTTTGCTGAAGATGGAGGTATTTAGGCTGGGCAAGAGGTGGTGAGGTAAATTGGGGTTTATCGATTATAGAACAGGTTCCTTTAGAGGGATATAAAGCACCGCCAAGTCCTTTGAGTTTTAAGCTGTTGC
+
A??ACDBCBB:B@BAAC@BC@@>AACBACBBCBBC@BB?@BBAABC@BBC@@BBBCBC@ADAADCD@ACCCCBDAACBBBCCD>CCBCCCDCCCCDAABCACABCDCDAACCCCCCCDCCCA@CBDDEBABDA7ED:CBCCDDDCDB?@C@
NGS GMAP alignment GSNAP aligner • 563 views
ADD COMMENT
1
Entering edit mode

Hi!do you have the same number of reads and sorted in the same order in both files?

ADD REPLY
1
Entering edit mode

Thank you iraun for your guidance. I haven't sorted my fastq files before, I think that's why I got this error. After sorting the fastq file and keeping only the paired reads, I was able to resolve it.

However, I'm getting the following error now.

enter image description here

I think it's because my reference genome has not been indexed correctly. Previously, I downloaded the indexed genome from this website (http://research-pub.gene.com/gmap/) (UCSC hg19/GRCh37)

Then I tried to index my reference genome using gmap_build, but I got the following error. Please guide me how I can resolve this issue.

enter image description here enter image description here

ADD REPLY
1
Entering edit mode

Glad that you manage to advance a bit at least. Regarding the new error.. I am not sure, can you try to specify -d chrM?

ADD REPLY
0
Entering edit mode

Thank you iraun for your guidance. I'm able to index the reference genome correctly, also I'm able to align my reads with reference genome.

ADD REPLY

Login before adding your answer.

Traffic: 3081 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6