bwa mem error [mem_sam_pe]
0
0
Entering edit mode
3 months ago
ongchip • 0

Hello, I had trimmed fastq files with trimmomatic 0.39, and I used pe files to perform bwa mem. However, there was the error and it' stopped. This is the message:

[mem_sam_pe] paired reads have different names: "A01057:210:H37TJDSX3:2:1160:10809:6621", "A01057:210:H37TJDSX3:2:1160:13774:6621"

[mem_sam_pe] paired reads have different names: "A01057:210:H37TJDSX3:2:1160:11080:6621", "A01057:210:H37TJDSX3:2:1160:13792:6621"

The file names of fastq.gz are "17_pe1.fastq.gz" and "17_pe2.fastq.gz" How can I solve it??

mem pair bwa • 554 views
ADD COMMENT
1
Entering edit mode

What is the command you have used to run bwa mem? Also, did you doublecheck the fastq files to make sure that each one have the same amount of reads, and sorted in the same way?

ADD REPLY
0
Entering edit mode

The command: nohup bwa mem -M -R "@RG\tID:HWI\tSM:17\tPL:ILLUMINA\tLB:so" -t 10 ../ref/Combined_pseudohap.phased.filtered.0.arcs.fasta.gz ../trimmed_data/17_pe1.fastq.gz ../trimmed_data/17_pe2.fastq.gz -o 17_pe.sam > 17_logs.txt &

How to doublecheck the fastq files?

ADD REPLY
0
Entering edit mode

You can use repair.sh utility from BBMap suite to check/re-sync your PE files.

repair.sh -Xmx4g in1=R1_001.fastq.gz in2=R2_001.fastq.gz out1=fixed_R1_001.fastq.gz out2=fixed_R2_001.fastq.gz outs=single.fastq.gz repair
ADD REPLY
0
Entering edit mode

I tried, but there was the message:

java.lang.Exception:
Mismatch between length of bases and qualities for read 10534463 (id=A01057:210:H37TJDSX3:2:1160:22535:6668 2:N:0:TCGTAGTG+CCAAGTCT).
# qualities=151, # bases=178

FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFF,FFF:FF:FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF
TCACTTACAGATATCAGAAACAAACTTTCGTCCACGATTGACTCTTCCGATGTTTCATCGTTGGACGACGATGGGAGATCACACAATAATTCTACGAAAACTAGAGCTTTCTTTGATTTGGATTTTACAAATTCCACAAATCTCCTGCCCAGTAGGATGTTGTAGTCAAGGTTTCCAT

This can be bypassed with the flag 'tossbrokenreads' or 'nullifybrokenquality'
        at shared.KillSwitch.kill(KillSwitch.java:96)
        at stream.Read.validateQualityLength(Read.java:217)
        at stream.Read.validate(Read.java:105)
        at stream.Read.<init>(Read.java:77)
        at stream.Read.<init>(Read.java:50)
        at stream.FASTQ.quadToRead_slow(FASTQ.java:851)
        at stream.FASTQ.toReadList(FASTQ.java:686)
        at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:107)
        at stream.FastqReadInputStream.nextList(FastqReadInputStream.java:93)
        at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:682)
        at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:658)
ADD REPLY
0
Entering edit mode

Mismatch between length of bases and qualities for read 10534463

You have a problem with your data file. Use the option indicated below with repair.sh to fix that problem

This can be bypassed with the flag 'tossbrokenreads' 
ADD REPLY
0
Entering edit mode

I had trimmed fastq files with trimmomatic 0.39

If you did this independently for the two files then that is the problem. You need to trim PE files together.

ADD REPLY
0
Entering edit mode

I performed it together with one command line not seperately.

ADD REPLY

Login before adding your answer.

Traffic: 1818 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6