modified bases in oligo/primer?
1
0
Entering edit mode
8 weeks ago
yb8d • 0

Hi All,

Can someone remind me what the Asterix (*), such as those appearing at the end of the line, mean in an oligo such as:

CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGAC GTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T

Best regards,

Yongde

chemistry DNA • 171 views
ADD COMMENT
0
Entering edit mode
8 weeks ago
ATpoint 68k

It usually stands for modified bases. I know them as PTO bonds when you order primers/oligos, but probably it is any modified base and you need to check the legend of the sequence provider.

ADD COMMENT

Login before adding your answer.

Traffic: 1655 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6