I am using the following command:
findMotifs.pl input.fa fasta ./Output -fastaBg bg.fa -len 8,10,12 -norevopp
The input and bg fasta have this structure and the bg fasta include all sequences in input plus many others:
>ENSMUST00000027125_Coq10b_mmu_chr1_55071635_55072702_+_utr_55071803_55072702(+)
ATTTCTTTTGAATTCCGCTCCCTTCTGCACTCTCAGCTCGCTACTCTGTTCTTCGATGAAGTTGTGAAACAAATGGTAGC AGCCTTTGAAAGAAGAGCCTGTAAACTGTATGGTCCAGAGACAAACATACCTCGGGAATTAATGCTTCATGAAATTCACC ACACCTAAGAGGAAAATATTAGCTGCCTCCACCTACTCTTGGCTAGTTTGTTCACTTCTAGGAAGTCCTTTTACCATCTG` TTGAGAAGTCAGAAAGCATTTGTTAAACCTGCCTTGATTCTAAGCCCGTGCTGTTGAAAATTTGCACATTGAACATGGAC CCACTTGTACATAGAATTATTTCTTCAATCAAGTGTGACTCTAAGTATCATGTACATTTGCAGGCTCCGACCACCTTTGT AATAACGGATGTCATCACTGTTGCTAGGATACCACATTCCTCGTTTGAGTGTACAGATGAACAAGTCTTTTAATTCTCAC CTTACATGAAAAGGTTAGCTGAGATACAATGTGTGTTATATTAACCATATCATGTTTAAGTTATTAGGTTCAGAGTATTT GTAACTTATTGTTATTCGGCATGCCATATGGCTTAGGGTATTTGAATAATCATATATTTACCATTAAAACTGTGATTTAA AGTATTGCTAATGAAGTCTTAGCACTTTGGGTATTTTAATTGTTCTTATGGGTAGCAGTAGATGATTCAGTGTTGTTGGG
However I get the following error:
Selected Options:
Input file = input.fa
Promoter Set = fasta
Output Directory = ./CPEB4
Will use FASTA files for motif finding
Target Sequences = input.fa
Background Sequences = bg.fa
Motif length set at 8, 10, 12,
Will not search the reverse strand
Using custom gene IDs for GO analysis
Parsing FASTA format files...
Progress: Step4 - removing redundant promoters
Progress: Step5 - adjusting background sequences for GC/CpG content...
Sequences processed:
0 total
Frequency Bins: 0.2 0.25 0.3 0.35 0.4 0.45 0.5 0.6 0.7 0.8
Freq Bin Count
Illegal division by zero at /software/HOMER/bin/assignGeneWeights.pl line 63.
Normalizing lower order oligos using homer2
Reading input files...
0 total sequences read
Autonormalization: 1-mers (4 total)
A inf% inf% -nan
C inf% inf% -nan
G inf% inf% -nan
T inf% inf% -nan
Autonormalization: 2-mers (16 total)
AA inf% inf% -nan
CA inf% inf% -nan
GA inf% inf% -nan
TA inf% inf% -nan
AC inf% inf% -nan
CC inf% inf% -nan
GC inf% inf% -nan
TC inf% inf% -nan
AG inf% inf% -nan
CG inf% inf% -nan
GG inf% inf% -nan
TG inf% inf% -nan
AT inf% inf% -nan
CT inf% inf% -nan
GT inf% inf% -nan
TT inf% inf% -nan
Autonormalization: 3-mers (64 total)
Normalization weights can be found in file: ./CPEB4/seq.autonorm.tsv
Converging on autonormalization solution:
...............................................................................
Final normalization: Autonormalization: 1-mers (4 total)
A inf% inf% -nan
C inf% inf% -nan
G inf% inf% -nan
T inf% inf% -nan
Autonormalization: 2-mers (16 total)
AA inf% inf% -nan
CA inf% inf% -nan
GA inf% inf% -nan
TA inf% inf% -nan
AC inf% inf% -nan
CC inf% inf% -nan
GC inf% inf% -nan
TC inf% inf% -nan
AG inf% inf% -nan
CG inf% inf% -nan
GG inf% inf% -nan
TG inf% inf% -nan
AT inf% inf% -nan
CT inf% inf% -nan
GT inf% inf% -nan
TT inf% inf% -nan
Autonormalization: 3-mers (64 total)
Progress: Step6 - Gene Ontology Enrichment Analysis
Skipping...
Progress: Step7 - Known motif enrichment
Reading input files...
0 total sequences read
1006 motifs loaded
Cache length = 11180
Using hypergeometric scoring
Checking enrichment of 1006 motif(s)
|0% 50% 100%|
=================================================================================
Illegal division by zero at /software/HOMER/bin/findKnownMotifs.pl line 152.
Progress: Step8 - De novo motif finding (HOMER)
Scanning input files...
!!! Something is wrong... are you sure you chose the right length for motif finding? !!! i.e. also check your sequence file!!!
Scanning input files...
!!! Something is wrong... are you sure you chose the right length for motif finding? !!! i.e. also check your sequence file!!!
-blen automatically set to 2
Scanning input files...
!!! Something is wrong... are you sure you chose the right length for motif finding? !!! i.e. also check your sequence file!!! Use of uninitialized value in numeric gt (>) at /software/HOMER/bin/compareMotifs.pl line 1394. !!! Filtered out all motifs!!! Job finished