LncTar error

0

Entering edit mode

3.2 years ago

kuntalasb ▴ 10

Hello,

I downloaded LncTar package from http://www.cuilab.cn/. I want to analyse RNA-RNA interaction. For this, I formatted my two input RNA fasta files according to the manual and examples provided with the LncTar package i.e.,

 >RNAid1
 Sequence in one line
 >RNAid2
 Sequence in one line

But, when I try running the command:

perl LncTar.pl -p 1 -l RNAfile1 -m RNAfile2 -d -0.1 -s T -o output.txt

I get the following error:

the format of file is error, Please check! The name and the sequence do not put in a row!

I have checked my input file multiple times, it is formatted according to the software's requirement. For your reference, both of my input files look like this:

>Cre00001921    
ATGGCTCCTGGTATAGGAAGCTAATATCTTTCCTTTTTAAGGTGGGGCTAGTTCAAAG
>Cre00000880    
GAATGACGCAAGCTCCTCTCTTCAATAAAGattttgaaCACAAATAATGGAATAAATCG

but I am clueless regarding this error. Can anyone help me in resolving this? Any assistance would be greatly appreciated.

Thank you

LncRNA LncTar mRNA • 1.5k views

ADD COMMENT • link updated 13 months ago by Ram 43k • written 3.2 years ago by kuntalasb ▴ 10

1

Entering edit mode

Can you try passing it to the web interface and see if it works? Your data seems pretty much ok! If there's something that you're missing, the web interface should warn you!

ADD REPLY • link 3.2 years ago by brunobsouzaa ▴ 830

0

Entering edit mode

I did actually. But then it takes a lot of time without giving any result. The server gets timed out with error 404.

ADD REPLY • link 3.2 years ago by kuntalasb ▴ 10

Login before adding your answer.