Question: Mapping statistics error from mirdeep2
2
gravatar for Jordan
6.5 years ago by
Jordan1.2k
Pittsburgh
Jordan1.2k wrote:

Hi,

I'm using mirdeep2 for finding miRNAs on mouse data. 

I ran mapper.pl as a first step. It runs well and give me output. But throws an error at the end about mapping statistics. Does anyone know what this error is? And I'm not sure if I should rely on my results because of this error.

I ran using the command:

mapper.pl Sample.fastq -e -h -p ~/refs/mm9 -s Sample.fa -t Sample.arf

And I get this error at the end:

# reads processed: 24468373
# reads with at least one reported alignment: 13415055 (54.83%)
# reads that failed to align: 10102035 (41.29%)
# reads with alignments suppressed due to -m: 951283 (3.89%)
Reported 18449906 alignments to 1 output stream(s)
Mapping statistics

#desc   total   mapped  unmapped        %mapped %unmapped
Use of uninitialized value $count2 in subtraction (-) at /opt/sam/miRDeep/2.0.5/mapper.pl line 630, <IN> line 18449906.
Use of uninitialized value $count in subtraction (-) at /opt/sam/miRDeep/2.0.5/mapper.pl line 630, <IN> line 18449906.
total: Use of uninitialized value $count in print at /opt/sam/miRDeep/2.0.5/mapper.pl line 630, <IN> line 18449906.
        Use of uninitialized value $count2 in print at /opt/sam/miRDeep/2.0.5/mapper.pl line 630, <IN> line 18449906.
        0       Use of uninitialized value $count in division (/) at /opt/sam/miRDeep/2.0.5/mapper.pl line 631, <IN> line 18449906.
Use of uninitialized value $count2 in division (/) at /opt/sam/miRDeep/2.0.5/mapper.pl line 631, <IN> line 18449906.
Illegal division by zero at /opt/sam/miRDeep/2.0.5/mapper.pl line 631, <IN> line 18449906.
mapper.pl rna-seq mirdeep2 • 3.7k views
ADD COMMENTlink modified 2.9 years ago by zunpengliu0 • written 6.5 years ago by Jordan1.2k
2
gravatar for Jordan
6.4 years ago by
Jordan1.2k
Pittsburgh
Jordan1.2k wrote:

I was able to solve the issue. I included a new option -m, and it started working well.

mapper.pl sample.fastq -e -h -m -v -p ~/refs/mm9 -s Sample.fa -t Sample.arf

Results:

parsing fastq to fasta format
discarding short reads
collapsing reads
mapping reads to genome index
# reads processed: 6409517
# reads with at least one reported alignment: 4426074 (69.05%)
# reads that failed to align: 1850959 (28.88%)
# reads with alignments suppressed due to -m: 132484 (2.07%)

Reported 4984883 alignments to 1 output stream(s)
trimming unmapped nts in the 3' ends
Mapping statistics
#desc   total   mapped  unmapped        %mapped %unmapped
total: 17205138 9753961 7451177 0.567   0.433
seq: 17205138   9753961 7451177 0.567   0.433
ADD COMMENTlink modified 9 months ago by RamRS30k • written 6.4 years ago by Jordan1.2k
0
gravatar for margxenscienculo
6.4 years ago by
Iberian Peninsule (SouthWestern Sector - Scorching Corner )
margxenscienculo50 wrote:

Hi. I am playing with the tutorial directory and I have the same problem. Have you fixed?

Regards.

/home/soba/Documentos/Ensambladores/mirdeep2/mapper.pl tomicus_yunaensamblado.fasta -c -i -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p /home/soba/Documentos/Ensambladores/mirdeep2/tutorial_dir/tomicus.index -s tomicus_prueba8.fa -t tomicus_prueba8_collapsed_vs_genome.arf -v
converting rna to dna alphabet
discarding sequences with non-canonical letters
clipping 3' adapters
Use of uninitialized value in transliteration (tr///) at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 65.
Use of uninitialized value $seq in pattern match (m//) at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 69.
Use of uninitialized value $seq in substr at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 73.
Use of uninitialized value $seq in pattern match (m//) at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 84.
Use of uninitialized value $seq in pattern match (m//) at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 84.
Use of uninitialized value $seq in pattern match (m//) at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 84.
Use of uninitialized value $seq in pattern match (m//) at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 84.
Use of uninitialized value $seq in pattern match (m//) at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 84.
Use of uninitialized value $seq in pattern match (m//) at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 84.
Use of uninitialized value $id in concatenation (.) or string at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 99.
Use of uninitialized value $seq_clipped in concatenation (.) or string at /home/soba/Documentos/Ensambladores/mirdeep2/clip_adapters.pl line 99.
discarding short reads
collapsing reads
Use of uninitialized value $query in pattern match (m//) at /home/soba/Documentos/Ensambladores/mirdeep2/collapse_reads_md.pl line 112.
Use of uninitialized value in transliteration (tr///) at /home/soba/Documentos/Ensambladores/mirdeep2/collapse_reads_md.pl line 79.
Use of uninitialized value $seq in hash element at /home/soba/Documentos/Ensambladores/mirdeep2/collapse_reads_md.pl line 80.
mapping reads to genome index
Warning: Could not find any reads in "dir_mapper_seq_tomicus_yunaensamblado.fasta_8830082664_29_05_2014_t_13_50_05/reads_nr.fa"
# reads processed: 0
# reads with at least one reported alignment: 0 (0.00%)
# reads that failed to align: 0 (0.00%)
No alignments
trimming unmapped nts in the 3' ends
Mapping statistics

#desc    total    mapped    unmapped    %mapped    %unmapped
Use of uninitialized value $count2 in subtraction (-) at /home/soba/Documentos/Ensambladores/mirdeep2/mapper.pl line 630.
total: 1    Use of uninitialized value $count2 in print at /home/soba/Documentos/Ensambladores/mirdeep2/mapper.pl line 630.
    1    Use of uninitialized value $count2 in division (/) at /home/soba/Documentos/Ensambladores/mirdeep2/mapper.pl line 631.
Use of uninitialized value $count2 in division (/) at /home/soba/Documentos/Ensambladores/mirdeep2/mapper.pl line 631.
0.000    1.000
Use of uninitialized value in subtraction (-) at /home/soba/Documentos/Ensambladores/mirdeep2/mapper.pl line 633.
seq: 1    Use of uninitialized value in print at /home/soba/Documentos/Ensambladores/mirdeep2/mapper.pl line 633.
    1    Use of uninitialized value in division (/) at /home/soba/Documentos/Ensambladores/mirdeep2/mapper.pl line 634.
Use of uninitialized value in division (/) at /home/soba/Documentos/Ensambladores/mirdeep2/mapper.pl line 634.
0.000    1.000
ADD COMMENTlink modified 9 months ago by RamRS30k • written 6.4 years ago by margxenscienculo50
0
gravatar for myneptune10000
3.0 years ago by
myneptune100000 wrote:

I also meet this problem.

But I found the index file I use is not right. At first, the index I use is produced by hisat. But miRDeep2 is using bowtie.

So the problem can be solved by using the right index.

Download here(for human):http://bowtie-bio.sourceforge.net/index.shtml

ADD COMMENTlink modified 3.0 years ago • written 3.0 years ago by myneptune100000
0
gravatar for zunpengliu
2.9 years ago by
zunpengliu0
zunpengliu0 wrote:

Hi, Jordan,

I meet the same problem,

Use of uninitialized value $count2 in subtraction (-)

but I still cannot solve the issue by adding option -m. Do you have suggestions.

Regards.

ADD COMMENTlink written 2.9 years ago by zunpengliu0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1029 users visited in the last hour