Blog posts collected by the Biostar aggregator. To follow subscribe to the planet feed
<prev • 2,219 results • page 2 of 89 • next >

Thoughts on my Salmon review

written 5 weeks ago by Living in an Ivory Basement by Titus Brown

I was one of the reviewers of the Salmon paper by Patro et al., 2017, Salmon provides fast and bias-aware quantification of transcript expression, and I posted my review in large part because of Lior Pachter's blog post levying charges of intellectual theft and dishonest against the Salmon authors. More …

DNA vs. the Machine

written 5 weeks ago by Omics! Omics! by Keith Robinson

Last week's news contained a story sure to raise eyebrows. A group of computer security researchers from the University of Washington claimed to have demonstrated that they could hijack a computer via sequencing a carefully-constructed DNA fragment. Visions of NextSeqs rampaging through the streets immediately sprung to mind. The paper is interesting and has some useful warnings for the bioinformatics community, but certainly the news coverage has been strong on hype and alarmism.Read more »

My Salmon review

written 5 weeks ago by Living in an Ivory Basement by Titus Brown

I was one of the reviewers of the Salmon paper by Patro et al., 2017, Salmon provides fast and bias-aware quantification of transcript expression. I was asked to review the paper on September 14, 2016, and submitted my review (or at least stopped getting reminders :) soon after October 20th. The review request stated, ... I would be grateful for your views on both the technical merits of this work and its interest to a broad readership. Please try the tool and report your experience. Let me know if you have issues with access. Brief Communications are intended to report concise studies of high quality and broad interest but are expected to be less substantial than Articles. Typically, a Brief Communication will describe a significant improvement to a tried-and-tested technique, its adaptation for a new application, or an important new tool of interest to the scientific community. and I reviewed the paper as requested. Below is the full text of my review as I submitted it. (Note that I have not been posting my reviews lately because I've been busy, and I don't have a simple automated system for doing it. In this case the review seems like it might be of general interest.) The authors present salmon, a new RNAseq quantification tool that uses pseudoalignment and is highly performant. The significant factors recommending salmon over other tools include speed, high sensitivity, correction for technical biases in sequencing, an open source license, and a robust implementation that is straightforward to ...

My Salmon review

written 5 weeks ago by Living in an Ivory Basement by Titus Brown

I was one of the reviewers of the Salmon paper by Patro et al., 2017, Salmon provides fast and bias-aware quantification of transcript expression. I was asked to review the paper on September 14, 2016, and submitted my review (or at least stopped getting reminders :) soon after October 20th. The …

Meet Nephele: Harness the Power of the Cloud for Your Microbiome Data Analysis

written 5 weeks ago by Kevin's GATTACA World

Nephele is a project from the National Institutes of Health (NIH) that brings together microbiome data and analysis tools in a cloud computing environment. It aims to address a major challenge facing researchers today — namely, analyzing, transferring, and storing biomedical "big data" — through the use of cloud-based resources Why Use Nephele?Liberating: Nephele enables you to break free from constraints imposed on high-throughput computational analysisSimple: Nephele is designed to be a no-hassle, easy-to-use tool to support your researchSophisticated: Nephele is the most intuitive, advanced and secure microbiome analysis platform designed by our experienced computational biologists and software development team to provide exceptional capability with little effort on your partFast: Nephele speeds up microbiome data analysis and paves the path to getting to your resultsEconomical: Nephele's on-demand, pay-as-you-go setup offers a cost-effective alternative to using of dedicated resources for your microbiome data analysisReady to get started? Visit https://nephele.niaid.nih.gov/ and enter your email address. Check your inbox for a message with the subject "Your Nephele Promotional Codes."Stay in touch! Email nephele@mail.nih.gov with your questions and feedback. You can also visit our Google+ community page to connect with other researchers in the microbiome community (https://plus.google.com/communities/107278901311674483366).Source: https://www.biostars.org/p/204081/

demo bam file Ion Torrent 314 chip of E. coli 400 bp run for download

written 5 weeks ago by Kevin's GATTACA World

BAM file of B22-730 (314v2 E. coli 400 bp run) Ion Torrent PGM 314v2 run with a mode read length of 400bp and per-base raw read accuracy &gt;99%.https://s3.amazonaws.com/ion-torrent/pgm/B22-730/B22-730.bamSource: https://apps.thermofisher.com/apps/publiclib/#/datasets

Getting to know us: Jyo from Web

written 6 weeks ago by Ensembl Blog

This month we’re meeting Jyothish Bhai, who works in the Ensembl web team. What is your job in Ensembl? I work as a senior Frontend Developer in the Ensembl Web team. Our team looks after all web related stuff, which includes collaborating Continue reading Getting to know us: Jyo from Web→

Friday SNPpets

written 6 weeks ago by The OpenHelix Blog

This week there’s an actual call to action in the tweets. See Steven Salzberg’s tweet about the 2017 Service to America award and GenBank is nominated–you can vote every day! The rest of the week’s intriguing tweets include yeast diversity, British historical diversity, non-coding regulatory stuff, computer-coding DNA hackers, and setting standards for information of […]

bwa-mem multi-mapping reads

written 6 weeks ago by Diving into Genetics and Genomics

An errorI was using TEQC to do quality control of my WES bam files aligned by bwa-mem. My data are paired end, so a function reads2pairs is called to make the paired-end reads to be a single fragment. I then get this error:&gt; readpairs &lt;- reads2pairs(reads)Error in reads2pairs(reads) : read pair IDs do not seem to be uniqueI asked in the bioconductor support site and went to the source code of that function. It turns out that TEQC was complaining about the not uniquely mapped reads.How does BWA-MEM determine and mark the not uniquely mapped reads?google directed me to biostars again with no surprising. Please read this three posts:https://www.biostars.org/p/76893/https://www.biostars.org/p/167892/one extract multi-mapped reads by looking for mapq &lt; 23 and/or the XA flag on the readssamtools view -q 40 file.bamsamtools view -q 1 file.bamsamtools view -q 23 file.bamBWA added tags (Tags starting with ‘X’ are specific to BWA):TagMeaningNMEdit distanceMDMismatching positions/basesASAlignment scoreBCBarcode sequenceX0Number of best hitsX1Number of suboptimal hits found by BWAXNNumber of ambiguous bases in the refereneceXMNumber of mismatches in the alignmentXONumber of gap opensXGNumber of gap extentionsXTType: Unique/Repeat/N/Mate-swXAAlternative hits; format: (chr,pos,CIGAR,NM;)*XSSuboptimal alignment scoreXFSupport from forward/reverse alignmentXENumber of supporting seedsChecking my own bam filessamtools view my.bam | grep "XA:" | head -2E00514:124:H2FC7CCXY:1:1221:16741:50076 97 1 69019 0 151M = 69298 430 CTCCTTCTCTTCTTCAAGGTAACTGCAGAGGCTATTTCCTGGAATGAATCAACGAGTGAAACGAATAACTCTATGGTGACTGAATTCATTTTTCTGGGTCTCTCTGATTCTCAGGAACTCCAGACCTTCCTATTTATGTTGTTTTTTGTAT @@CC?=D@E@=F@&gt;F&gt;?FG==?FAGG?F?FFGA&lt;=?&gt;GFAGF?@=G&gt;?=F?&gt;E@&gt;F=G&gt;&gt;&gt;E?=&gt;&gt;;&gt;D@E@;&lt;EE&lt;E=CAE&lt;&gt;;&lt;D@&lt;&lt;&lt;==D@ED@&lt;D@D@E&gt;E&lt;&lt;=D@E@E&gt;=&gt;C@DD@E=CD@&lt;DD@&lt;&gt;=&gt;&lt;&gt;G&gt;&gt;G&gt;&gt;&gt;=;;?;;&gt; XA:Z:15,-102463184,151M,0;19,+110607,151M,1; MC:Z:151M BD:Z:NNNNNNNONONNONNONNOONNNOOONONOONONNNGNNNOONNNOONNOONNNOOOMONFNNONNNNNONONNOOOMOOOOONNNNOONGGGNOOOLOOONONOOOONNONOOONNNONNOONOONNNNNNNNGNNOMNNMNGGGGNMNN MD:Z:151 BI:Z:QQPQQQQPOPQQQQQQQQQQQQQQRQQRQQQQRQQQMQQQRRQQQRQQQRQQQQQQRQQQKQQQQQQQQQPQQQRRQQQQQRQQQQQQQQMMMQQRRPQRQPQPQRQRQQQPQRQQQQQPQQRQQQQQQQQQQQMQQRQQQQQMMMMQQQQ NM:i:0 MQ:i:0 AS:i:151 XS:i:151 RG:Z:F17042956987-KY290-2-WESE00514:124:H2FC7CCXY:1:2219:12855:17641 81 1 69039 0 150M 13 83828251 0 AACTGCAGAGGCTATTTCCTGGAATGAATCAACGAGTGAAACGAATAACTCTATGGTGACTGAATTCATTTTTCTGGGTCTCTCTGATTCTCAGGAACTCCAGACCTTCCTATTTATGTTGTTTTTTGTATTCTATGGAGGAATCGTGTT =;C?FEAFAFGF&lt;&gt;&gt;&gt;=FF@DD=&lt;@D=&lt;;E&lt;&lt;?D@C@E=&lt;&lt;?D;&lt;;&lt;&lt;E&lt;E;=@DC@D&lt;E@D=&lt;==E&lt;&gt;&gt;=&gt;&lt;E@EDD&lt;E=E=E@D&lt;&gt;&gt;F&gt;G@CF&gt;=F&gt;FGAF=GF@?FG===&gt;&lt;=@E??E??????F==??F==?FF@EE=&lt;=&gt;D@B@@ XA:Z:15,+102463165,150M,0;19,-110627,150M,1; BD:Z:NOONOOONNNOONNFNNOOONNNOONNOONNNNNOMONGNNNNNNNNOONONOOOMOOOOONNNNOONFFFNNOOLOONONONOOONNNOOONNNNOONOOOOOONNNOONNFNNOMNNMNFFFFNMNNNNNONOONNNNNNOONMMNNN MD:Z:150 BI:Z:QRRQQRQPQQRQQQKQQQRQQQQQQQQRQQQQQPQPQQMQQQQQQQQRQQQQQQQPQRRRQQQQQQRQKKKQQRQPQQQQQQQRQRQQQQQRQQQQRQQRRQRQQQQQQQQQKQQQOQQOQKKKKQOQQQQQQQQQQPQQPPQQQPOQQQ NM:i:0 AS:i:150 XS:i:150 RG:Z:F17042956987-KY290-2-WESIndeed, most of the reads with XA: tag has a quality score ...

Computational Biology &amp; Math: Am I Just Faking It?

written 6 weeks ago by Omics! Omics! by Keith Robinson

Over on Quora a common type of question is "Can I be a computational biologist if I am now an X". Personally I take a very broad view and think just about anyone with intellectual curiosity can become any kind of scientist. A related type of question is "how skilled do I need to be in Y to succeed in computational biology", where Y is most often programming, biology or math. I got thinking about this and started wondering whether I am actually at all skilled in math. Here is the results of that analysis.Read more »

dangerous rm command

written 7 weeks ago by Diving into Genetics and Genomics

rm command is very dangerous because after you remove something, you can not recover it. There is no trash bin in the unix system. If you have some raw data (e.g fastq files), you'd better make them safe by changing the file permissions. in an empty directory, make a folder foo:mkdir testcd testmkdir foocd footouch {1..4}.fastqsls1.fastqs 2.fastqs 3.fastqs 4.fastqscd ..let's first make the foo directory unwritablels -ldrwxr-x--- 2 krai genomic_med 512 Aug 4 22:27 fools -l foototal 0-rw-r----- 1 krai genomic_med 0 Aug 4 22:31 1.fastqs-rw-r----- 1 krai genomic_med 0 Aug 4 22:31 2.fastqs-rw-r----- 1 krai genomic_med 0 Aug 4 22:31 3.fastqs-rw-r----- 1 krai genomic_med 0 Aug 4 22:31 4.fastqs#remove the write privilege for the foo folderchmod u-w fools -l dr-xr-x--- 2 krai genomic_med 512 Aug 4 22:31 foo# the files inside the foo folder does not changels -l foo-rw-r----- 1 krai genomic_med 0 Aug 4 22:31 1.fastqs-rw-r----- 1 krai genomic_med 0 Aug 4 22:31 2.fastqs-rw-r----- 1 krai genomic_med 0 Aug 4 22:31 3.fastqs-rw-r----- 1 krai genomic_med 0 Aug 4 22:31 4.fastqs# now you can not remove the foo folder:rm -rf foorm: cannot remove `foo/2.fastqs': Permission deniedrm: cannot remove `foo/1.fastqs': Permission deniedrm: cannot remove `foo/4.fastqs': Permission deniedrm: cannot remove `foo/3.fastqs': Permission denied# rm -rf foo/*rm: cannot remove `foo/1.fastqs': Permission deniedrm: cannot remove `foo/2.fastqs': Permission deniedrm: cannot remove `foo/3.fastqs': Permission deniedrm: cannot remove `foo/4.fastqs': Permission deniedlet's make the fastq files unwritable, but change the foo folder back to default:chmod u+w fools -l drwxr-x--- 2 krai genomic_med 512 Aug 4 22:31 foochmod ...

Years as coloured bars

written 7 weeks ago by What You're Doing Is Rather Desperate by Neil Saunders

I keep seeing years represented by coloured bars. First it was that demographic tsunami chart. Then there are examples like the one on the right, which came up in a web search today. I even saw one (whispers) at work today. I get what they are trying to do – illustrate trends within categories over … Continue reading Years as coloured bars

Friday SNPpets

written 7 weeks ago by The OpenHelix Blog

This week there’s an actual call to action in the tweets. See Steven Salzberg’s tweet about the 2017 Service to America award. You can vote for Genbank. Really–try to imagine the last couple of decades without it. And it’s time to celebrate government science in front of the public. Go vote. After that, come back […]

I was wrong (part 2)

written 7 weeks ago by Bits of DNA by Lior Pachter

Two years ago I wrote a blog post on being wrong. It’s not fun to admit being wrong, but sometimes it’s necessary. I have to admit to being wrong again. In May 2015 my coauthors and I released software called kallisto for RNA-Seq and we published a preprint concurrently. Several months before that, in February […]

Creating filtered fastq files of ONLY mapped reads from a BAM file

written 7 weeks ago by Kevin's GATTACA World

Filtering BAM files for mapped or unmapped readsTo get the unmapped reads from a bam file use :samtools view -f 4 file.bam &gt; unmapped.sam, the output will be in samto get the output in bam use : samtools view -b -f 4 file.bam &gt; unmapped.bamTo get only the mapped reads use the parameter 'F', which works like -v of grep and skips the alignments for a specific flag.samtools view -b -F 4 file.bam &gt; mapped.bamSource: https://www.biostars.org/p/56246/ Sukhdeep SinghTo do this as efficiently as possible, using BBTools:reformat.sh in=reads.sam out=mapped.fq mappedonlyAlso, BBMap has a lot of options designed for filtering, so it can output in fastq format and separate mapped from unmapped reads, preventing the creation of intermediate sam files. This approach also keeps pairs together, which is not very easy using samtools for filtering.bbmap.sh ref=reference.fa in=reads.fq outm=mapped.fq outu=unmapped.fqSource: https://www.biostars.org/p/127992/ Brian Bushnell

To do analysis stuff

written 7 weeks ago by What You're Doing Is Rather Desperate by Neil Saunders

First there was “insert statistical method here“. Now we have R – making it easy “to do analysis stuff“. Via Elisabeth; I’ll hand you over now for an entertaining summary. To be fair, analysis stuff describes my working life quite well. Filed under: humour, publications, uncategorized

Twitter Coverage of the ISMB/ECCB Conference 2017

written 7 weeks ago by What You're Doing Is Rather Desperate by Neil Saunders

ISMB (Intelligent Systems for Molecular Biology – which sounds rather old-fashioned now, doesn’t it?) is the largest conference for bioinformatics and computational biology. It is held annually and, when in Europe, jointly with the European Conference on Computational Biology (ECCB). I’ve had the good fortune to attend twice: in Brisbane 2003 (very enjoyable early in … Continue reading Twitter Coverage of the ISMB/ECCB Conference 2017

How not to perform a differential expression analysis (or science)

written 7 weeks ago by Bits of DNA by Lior Pachter

Spot the difference One of the maxims of computational biology is that “no two programs ever give the same result.” This is perhaps not so surprising; after all, most journals seek papers that report a significant improvement to an existing method. As a result, when developing new methods, computational biologists ensure that the results of their […]

Friday SNPpets

written 8 weeks ago by The OpenHelix Blog

I stayed up late last night to see if I’d have health care this morning, and I got off schedule. But off we go–still insured! This Friday includes the first ever tardigrade protein structure! It’s bigger on the inside–wait, no, wrong thing. Human wise, we have recreational genomics apps, and we have recreational genomics consequences. Epigenetic […]

Twitter Coverage of the Bioinformatics Open Source Conference 2017

written 8 weeks ago by What You're Doing Is Rather Desperate by Neil Saunders

July 21-22 saw the 18th incarnation of the Bioinformatics Open Source Conference, which generally precedes the ISMB meeting. I had the great pleasure of attending BOSC way back in 2003 and delivering a short presentation on Bioperl. I knew almost nothing in those days, but everyone was very kind and appreciative. My trusty R code … Continue reading Twitter Coverage of the Bioinformatics Open Source Conference 2017

Hacking Highcharter: observations per group in boxplots

written 8 weeks ago by What You're Doing Is Rather Desperate by Neil Saunders

Highcharts has long been a favourite visualisation library of mine, and I’ve written before about Highcharter, my preferred way to use Highcharts in R. Highcharter has a nice simple function, hcboxplot(), to generate boxplots. I recently generated some for a project at work and was asked: can we see how many observations make up the … Continue reading Hacking Highcharter: observations per group in boxplots

a Bioinformatician in the Big Pharma

written 8 weeks ago by BioinfoBlog.it

The last 18 months have been quite a radical career change for me. This is because I made the infamous move: leaving the Academia and starting working in the Industry. To be honest I am quite happy of the change. I’ve learned many things, discovered another way to do science, and possibly made some contributions. Moving from…

A Third GridION X5 Pricing Plan

written 9 weeks ago by Omics! Omics! by Keith Robinson

When Oxford Nanopore announced their GridION X5 instrument in March, I and others attempted to parse the difference between the two pricing plans -- and I made a bit of a hash of it. The X5 runs 5 MinION flowcells independently in parallel from a single desktop instrument, which also includes FPGA-based acceleration of basecalling plus a license to perform sequencing-for-hire. Indeed, Matt Loose tweeted out an image of an "X6" and then mention of an "X7"; the X6 had a MinION plugged into the USB port and apparently the FPGA unit can keep up with seven flowcells all running simultaneously. Now Oxford has launched an interesting third "Starter Pack" plan that offers an even lower price point for the system.Read more »

Chart golf: the “demographic tsunami”

written 9 weeks ago by What You're Doing Is Rather Desperate by Neil Saunders

“‘Demographic tsunami’ will keep Sydney, Melbourne property prices high” screams the headline. While the census showed Australia overall is aging, there’s been a noticeable lift in the number of people aged between 25 to 32. As the accompanying graph shows… Whoa, that is one ugly chart. First thought: let’s not be too hard on Fairfax … Continue reading Chart golf: the “demographic tsunami”

Friday SNPpets

written 9 weeks ago by The OpenHelix Blog

This week I’m taking a different tack. There was something bothering me about misuse of genomics, and I’m going to rant on that. Recently a friend pointed me to something that I hadn’t seen before: cranks are misusing 23andMe-type of data to “diagnose” kids as being likely to suffer “vaccine injury”. As you might recognize from […]
<prev • 2,219 results • page 2 of 89 • next >

Planet Feeds

The OpenHelix Blog
A news portal with postings about genomics resources, genomics news and research, science and more.
391 posts, last updated 1 day ago
Living in an Ivory Basement by Titus Brown
bioinformatics education, metagenomics assembly, python programming
212 posts, last updated 3 days ago
Omics! Omics! by Keith Robinson
A computational biologist's personal views on new technologies & publications on genomics & proteomics and their impact on drug discovery
207 posts, last updated 4 days ago
Ensembl Blog
News about the Ensembl Project and its genome browser
126 posts, last updated 11 days ago
What You're Doing Is Rather Desperate by Neil Saunders
Notes from the life of a computational biologist
92 posts, last updated 15 days ago
Bits of DNA by Lior Pachter
Reviews and commentary on computational biology
79 posts, last updated 21 days ago
Opinionomics by Mick Watson
bioinformatics, genomes, biology etc. "I don't mean to sound angry and cynical, but I am, so that's how it comes across"
42 posts, last updated 4 weeks ago
MassGenomics by Dan Koboldt
Medical genomics in the post-genome era
66 posts, last updated 5 weeks ago
Kevin's GATTACA World
Weblog on Bioinformatics, Genome Science and Next Generation Sequencing
66 posts, last updated 5 weeks ago
Diving into Genetics and Genomics
A wet lab biologist' bioinformatic notes. Mostly is about Linux, R, python, reproducible research, open science and NGS. I am into data science! I am working on glioblastoma (a terrible brain cancer) genomics at MD Anderson cancer center. Disclaimer: For posts that I copied from other places, credits go to the original authors.
42 posts, last updated 6 weeks ago
BioinfoBlog.it
This blog is written by Giovanni M. Dall’Olio, a research associate at the Cancer Evolutionary Genomics‘s group of Francesca Ciccarelli at the King’s College of London. My primary interests are in the system biology of cancer and in identifying new potential drug targets for this disease.
13 posts, last updated 8 weeks ago
Bioinformatics I/O
Tips && tricks from a cluster of bioinformaticians
13 posts, last updated 9 weeks ago
Inside UniProt
News and commentary from the UniProt developers
28 posts, last updated 10 weeks ago
thoughts about ...
My worklog on bioinformatics, science and research. Small tasks and cute tricks included :)
34 posts, last updated 4 months ago
The Grand Locus
My name is Guillaume Filion. I am a scientist who loves biology and mathematics. As of late I also got into computers and the Internet. I intend my blog to be recreational, and not academic nor educational. I wish you will find some of the posts inspiring for your own reflection.
27 posts, last updated 4 months ago
Next Gen Seek
Making Sense of Next-Gen Sequencing Data
83 posts, last updated 4 months ago
In between lines of code by Lex Nederbragt
Biology, sequencing, bioinformatics and more
31 posts, last updated 6 months ago
Getting Genetics Done by Stephen Turner
Getting Things Done in Genetics & Bioinformatics Research
60 posts, last updated 7 months ago
YOKOFAKUN by Pierre Lindenbaum
virology, bioinformatics, genetics, science, java
65 posts, last updated 8 months ago
Bioinformatician at large by Ewan Birney
Thoughts and opinions from the associate director of the EMBL-European Bioinformatics Institute
57 posts, last updated 9 months ago
The Genome Factory
Bioinformatics tips, tricks, tools and commentary with a microbial genomics bent. Written by Torsten Seemann from Melbourne, Australia.
25 posts, last updated 12 months ago
The Genome Factory
Bioinformatics tips, tricks, tools and commentary - all with a microbiological NGS bent. Authored by Dr Torsten Seemann from Melbourne, Australia.
29 posts, last updated 12 months ago
Bits of Bioinformatics by Páll Melsted
Assistant professor of computer science at University of Iceland.
8 posts, last updated 15 months ago
Homolog.us - Bioinformatics by Manoj Samanta
Frontier in Bioinformatics
185 posts, last updated 16 months ago
Blue Collar Bioinformatics by Brad Chapman
bioinformatics, biopython, genomic analysis
38 posts, last updated 17 months ago
opiniomics by Mick Watson
bioinformatics, genomes, biology etc. "I don't mean to sound angry and cynical, but I am, so that's how it comes across"
78 posts, last updated 20 months ago
Bergman Lab
21 posts, last updated 2.8 years ago
Genomes Unzipped
A group blog providing expert, independent commentary on the personal genomics industry.
34 posts, last updated 2.9 years ago
miRBase blog
miRBase news and views
14 posts, last updated 3.1 years ago
Bio and Geo Informatics by Brent Pedersen
Genomics Programming
25 posts, last updated 3.8 years ago
Jermdemo Raised to the Law by Jeremy Leipzig
Mostly bioinformatics, NGS, and cat litter box reviews
25 posts, last updated 4.0 years ago

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 672 users visited in the last hour