User: gauravdube007

Reputation:
0
Status:
New User
Last seen:
3 years, 2 months ago
Joined:
6 years, 6 months ago
Email:
g************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by gauravdube007

<prev • 15 results • page 2 of 2 • next >
0
votes
2
answers
1.9k
views
2
answers
Comment: C: Rna Base Paring
... Hello Fabrice Jossinet,  can you please help me with this post ?? Can Anyone Suggest Me A Program For Converting Dot-Bracket Notation Format To Standard Hybridization Format. Thanks in advance. ...
written 6.5 years ago by gauravdube0070
0
votes
3
answers
3.7k
views
3
answers
Comment: C: How To Align Then Visualize The Alignment Of Rna Sequences With R Or Python
... Hey, ifreak can you please help me with [this post](/p/97476/)? Thanks in advance. ...
written 6.5 years ago by gauravdube0070 • updated 10 months ago by RamRS30k
0
votes
1
answer
1.5k
views
1
answers
Comment: C: Rna Structure Parsing Software
... Hey, AndreiR can you please help me with [this post](https://www.biostars.org/p/97476/)? Thanks in advance. ...
written 6.5 years ago by gauravdube0070 • updated 10 months ago by RamRS30k
0
votes
1
answer
3.7k
views
1
answers
Comment: C: How To Create Dot-Bracket Annotation For Rna With Pseudoknots
... Hey, Niklas can you please help me with this post? Can Anyone Suggest Me A Program For Converting Dot-Bracket Notation Format To Standard Hybridization Format. Thanks in advance. ...
written 6.5 years ago by gauravdube0070 • updated 10 months ago by RamRS30k
0
votes
0
answers
2.8k
views
0
answers
Can Anyone Suggest Me A Program For Converting Dot-Bracket Notation Format To Standard Hybridization Format.
... Hello, I am interested in converting: Dot-Bracket notation format to Standard hybridization format. Example : Dot-Bracket notation - UGACGAUCAAAGGUGGGCCACU&GUGGCCAACUUCUAGUCAU ((((......((((.((((((.&)))))).))))...)))). to Standard hybridization format - GAUCAA ...
sequence format rna conversion written 6.6 years ago by gauravdube0070

Latest awards to gauravdube007

Popular Question 4.5 years ago, created a question with more than 1,000 views. For How to generate a scale for a phylogenetic tree?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1719 users visited in the last hour