User: ddzhangzz

gravatar for ddzhangzz
ddzhangzz40
Reputation:
40
Status:
New User
Location:
United States
Last seen:
2 days, 21 hours ago
Joined:
2 years, 11 months ago
Email:
d********@gmail.com

Posts by ddzhangzz

<prev • 30 results • page 1 of 3 • next >
5
votes
1
answer
86
views
1
answer
Quick check of the RNASeq length for a bunch of files
... I have >500 fastq.gz files from a RNASeq project and was told they have been run with either 125bp or 50bp. I am wondering if there is a quick way to check which files are 125bp and which are 50bp. One file seems not bad to check but for 500 files I wanted to find a better way. ...
rna-seq written 10 days ago by ddzhangzz40 • updated 10 days ago by genomax226k
3
votes
2
answers
131
views
5 follow
2
answers
Extract mutations for a specific gene from a vcf file
... I downloaded more than 4000+ VCF files from TCGA but I am only interested in mutations of one gene, IDH1. I am wondering what is the best way to extract the mutations of this gene from these VCF files. Desired output would be a data matrix. Is there a vcf tools can realize this? ...
vcf written 24 days ago by ddzhangzz40 • updated 24 days ago by Santosh Anand1.6k
0
votes
1
answer
92
views
1
answer
From bam files to isoform read counts
... I downloaded RNASeq bam files from TCGA data portal. I am interested in the expression analysis at isofrom level and wondering how to translate these bam files into counts at each isoform. I have done some analysis at gene level using star or htseq-count but fresh to isoform analysis. Could somebody ...
rna-seq written 4 weeks ago by ddzhangzz40 • updated 4 weeks ago by b.nota2.9k
0
votes
1
answer
108
views
1
answers
Comment: C: cutadapt cut the whole sequence from RNASeq fastq file
... Thanks! What do you mean not genomic? How do you know that? ...
written 10 weeks ago by ddzhangzz40
0
votes
1
answer
108
views
1
answers
Comment: C: cutadapt cut the whole sequence from RNASeq fastq file
... why? if manually remove the adapter `GATCGGAAGAGCACACGTCTGAACTCCAGTCAC` from the seq, the trimmed should be `CGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAACAAAAAAATAAGCAGAGTTGTCAAAGTAAAAACAAAACAAAAAATAATAAGAA`? ...
written 10 weeks ago by ddzhangzz40
0
votes
1
answer
108
views
1
answer
cutadapt cut the whole sequence from RNASeq fastq file
... One of sequences in my RNASeq fastq file looks like: @7001458:226:C989WANXX:3:1102:17546:38724 1:N:0:CGATGT GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAACAAAAAAATAAGCAGAGTTGTCAAAGTAAAAACAAAACAAAAAATAATAAGAA + BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF< ...
rna-seq written 10 weeks ago by ddzhangzz40
0
votes
0
answers
175
views
0
answers
Annotation document for Agilent G4851C (SurePrint G3 Human Gene Expression V3 Microarray Kit )
... I was trying to map Agilent G4851C (Design ID 072363) ProbeID to Entrez ID. I cannot find the annotation specifically for this. I was using hgug4112a.db package in R but only 1/3 can be mapped. I thought it may be an incorrect one. Does somebody know where can I find the annotation for this kit or h ...
microarray written 12 weeks ago by ddzhangzz40
0
votes
1
answer
249
views
1
answers
Comment: C: Alternative splicing analysis of targeted RNASeq data
... Thanks to @EagleEye. but what I am interested is how to do it for targeted RNASeq data in AS analysis (for selected genes). ...
written 3 months ago by ddzhangzz40
1
vote
1
answer
249
views
1
answer
Alternative splicing analysis of targeted RNASeq data
... My client has run targeted RNA sequencing for a list of genes from different chromosomes in human and wanted to perform alternative splicing analysis. I have never been working on these type of targeted data analysis and am wondering whether there is standard ways for this analysis. What programs I ...
rna-seq written 3 months ago by ddzhangzz40 • updated 3 months ago by EagleEye3.5k
1
vote
1
answer
494
views
1
answer
How to link TCGA/GDC HTSeq or FPKM data with clinical data?
... I retrieved FPKM-UQ data (disease=GBM) from TCGA/GDC data portal and am wondering how to link the data with clinical data. The manifest file was looking like this: id filename md5 size state 000e76af-9529-4e0b-b300-c602f5f717d2 b836a8d2-7c37-4af5-9f2f-7bf0121717f9.FPKM-UQ.txt.gz 9e947e2561 ...
rna-seq written 5 months ago by ddzhangzz40 • updated 11 weeks ago by Smandape60

Latest awards to ddzhangzz

Popular Question 5 months ago, created a question with more than 1,000 views. For plink analysis including covariates and gxe
Scholar 12 months ago, created an answer that has been accepted. For A: Align RNASeq reads to combined genomes

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 722 users visited in the last hour