User: ddzhangzz

gravatar for ddzhangzz
ddzhangzz80
Reputation:
80
Status:
Trusted
Location:
United States
Last seen:
1 week, 4 days ago
Joined:
4 years, 3 months ago
Email:
d********@gmail.com

Posts by ddzhangzz

<prev • 46 results • page 1 of 5 • next >
1
vote
1
answer
92
views
1
answer
How to change SM tag in bam file
... I have a bam file with header such like this: @RG ID:S1-L001 LB:L001 PL:Illumina SM:L001 PU:novaSeq @RG ID:S1-L002 LB:L002 PL:Illumina SM:L002 PU:novaSeq This bam file was generated by picard `MergeSamFiles` where one sample library was sequenced in two lanes (L001, L002) but I need to cor ...
next-gen written 27 days ago by ddzhangzz80 • updated 27 days ago by ATpoint6.6k
0
votes
1
answer
159
views
1
answer
Is there a way to retrieve peptide motifs based on MAF/VEP output?
... Using the Ensembl's Variant Effect Predictor (VEP) program I evaluated the variants identified form GATK::MuTect2. The output looks like this: Uploaded_variation Location Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position ...
next-gen written 11 weeks ago by ddzhangzz80 • updated 11 weeks ago by Denise - Open Targets4.6k
0
votes
1
answer
166
views
1
answers
Comment: C: how to split a bam file by read prefix
... Thanks but each split file is same as the original in.bam (didn't split the seqs)? ...
written 5 months ago by ddzhangzz80
0
votes
1
answer
166
views
1
answer
how to split a bam file by read prefix
... I have a bam file such like this: sample1_100000007 4 * 0 0 * * 0 0 AGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGTGTAGCGGTGAAATGCGTAGATATATGGAGGAACACCGGTGGCGAAAGCGGCTCTCTGGTCTGTAACTGA ...
rna-seq written 5 months ago by ddzhangzz80 • updated 5 months ago by Pierre Lindenbaum111k
0
votes
1
answer
578
views
1
answers
Comment: C: How has StringTie caculated the transcript coverage?
... ENST00000269305.7 and ENST00000620739.3 are truely identical in exons assembly (even they are assigned to different Ensembl IDs) (probably due to they have differently AA seq). These cases also seem not rare and we found at least "5" duplicated transcripts in one gene. My question was to understand ...
written 6 months ago by ddzhangzz80
2
votes
1
answer
578
views
5 follow
1
answer
How has StringTie caculated the transcript coverage?
... Recently I have used Stringtie to compute the reads of RNASeq mapping to transcripts. There are two transcripts of a gene with exactly same length and number of exons (as well as the assembly structure of the two transcripts) and I found the coverages were very different from each other. ##tra ...
rna-seq written 7 months ago by ddzhangzz80 • updated 6 months ago by geo.pertea60
2
votes
1
answer
651
views
1
answer
How to download NCBI sequences using a list of Refseq IDs?
... I have a list of Refseq IDs such as: [1] "NM_010220" "NM_001290393" "NM_007743" "NM_175344" "NM_029432" [6] "NM_001111121" "NM_153399" "NM_007592" "NM_181402" "NM_013737" 11] "NM_007737" "NM_029967" "NM_146062" "NM_019477" "NM_172746" 16] "NM_0241 ...
R written 9 months ago by ddzhangzz80
2
votes
1
answer
388
views
1
answer
How to screen TCGA population for a specific mutation using a COSMIC ID
... I am working on a TCGA breast cancer dataset and wanted to check the prevalence of a specific mutation in this population. If I found an interested mutation from COSMIC, I am wondering how I can link or screen this COSMIC ID (e.g. COSM43759) in the TCGA population. Does somebody have experiences on ...
next-gen written 9 months ago by ddzhangzz80 • updated 9 months ago by Kevin Blighe26k
0
votes
1
answer
414
views
1
answers
Comment: C: Why Trimmoatic assign paired sequences to unpaired after adapter trimming
... Thanks for your reply @Brian Bushnell. My sequence length is 151bp and I guess the length may be unlikely below 50bp even after adapter timmimg off. In what reasons do you think the sequence was eliminated? ...
written 10 months ago by ddzhangzz80
0
votes
1
answer
414
views
1
answer
Why Trimmoatic assign paired sequences to unpaired after adapter trimming
... I manually checked the output of the Trimmomatic and was confused that a paired seqs were assigned to unpaired in the output. Here is my Trimmomatic command line: java -Xms8g -jar Trimmomatic.jar PE -threads 6 -phred33 sample1_R1.fastq.gz sample1_R2.fastq.gz sample1_forward_paired.fastq.gz samp ...
rna-seq written 10 months ago by ddzhangzz80

Latest awards to ddzhangzz

Popular Question 3 months ago, created a question with more than 1,000 views. For STAR outputs empty alignment
Popular Question 3 months ago, created a question with more than 1,000 views. For STAR outputs empty alignment
Popular Question 6 months ago, created a question with more than 1,000 views. For STAR outputs empty alignment
Popular Question 6 months ago, created a question with more than 1,000 views. For Should adapters for RNASeq be removed before alignment?
Popular Question 6 months ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 14 months ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 15 months ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 20 months ago, created a question with more than 1,000 views. For plink analysis including covariates and gxe
Scholar 2.3 years ago, created an answer that has been accepted. For A: Align RNASeq reads to combined genomes

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1503 users visited in the last hour