User: ddzhangzz

gravatar for ddzhangzz
ddzhangzz40
Reputation:
40
Status:
New User
Location:
United States
Last seen:
1 day, 2 hours ago
Joined:
3 years, 1 month ago
Email:
d********@gmail.com

Posts by ddzhangzz

<prev • 35 results • page 1 of 4 • next >
0
votes
1
answer
106
views
1
answers
Comment: C: How to subset a UCSC table
... Thanks! It works. Never thought it was caused by name...:(. ...
written 20 days ago by ddzhangzz40
0
votes
1
answer
106
views
1
answers
Comment: C: How to subset a UCSC table
... $ ll /data/projects/JingChen-TCGA/Alternative_splicing/Data/UCSC/local total 8 -rw-r--r-- 1 3849 Jun 8 14:20 TP53-ensGene.txt -rw-r--r-- 1 4015 Jun 8 11:21 TP53-Homo_sapiens_Transcript_Summary.txt ...
written 20 days ago by ddzhangzz40
2
votes
1
answer
106
views
1
answer
How to subset a UCSC table
... I downloaded `ensGene.txt` file from [UCSC here][1] and wanted to create custom GFF annotation for [MISO][2]. I can generate the GFF annotation using the entire ensGene.txt file but I am only interested to generate for a small subset. Then I create a subset by grep such like: $grep ENSG00000141 ...
assembly written 20 days ago by ddzhangzz40
0
votes
1
answer
98
views
1
answers
Comment: C: Check the DNA strands source information of paired RNA-Seq fastq data
... Thanks @Devon Ryan! Could you have some explanation of the -f and -F options? And I got same numbers from my case: samtools view -c -f 32 -F 256 C92LDANXX_s8_1_B01_0249_SL152940Aligned.out.bam 19770944 samtools view -c -f 16 -F 256 C92LDANXX_s8_1_B01_0249_SL152940Aligned.out.bam 1 ...
written 5 weeks ago by ddzhangzz40
3
votes
1
answer
98
views
1
answer
Check the DNA strands source information of paired RNA-Seq fastq data
... I would like to check which DNA strands where my RNASeq have come from. I checked a couple of them by browsing UCSC: R1 Read: @HISEQ-WALDORF:249:C92LDANXX:8:1101:3161:1988 NTCGAGACTTCTTATAATTTGCATAATCCTCCAAAATGGAATCCACATTCTTCTTGGCAGGAAGATAAAAAAGCTGCTTCTGTCTGGTGATCAAGTCCCAGTCATCCACAAGCCAGGG ...
rna-seq written 5 weeks ago by ddzhangzz40 • updated 5 weeks ago by Devon Ryan68k
5
votes
1
answer
115
views
1
answer
Quick check of the RNASeq length for a bunch of files
... I have >500 fastq.gz files from a RNASeq project and was told they have been run with either 125bp or 50bp. I am wondering if there is a quick way to check which files are 125bp and which are 50bp. One file seems not bad to check but for 500 files I wanted to find a better way. ...
rna-seq written 10 weeks ago by ddzhangzz40 • updated 9 weeks ago by genomax29k
3
votes
2
answers
195
views
5 follow
2
answers
Extract mutations for a specific gene from a vcf file
... I downloaded more than 4000+ VCF files from TCGA but I am only interested in mutations of one gene, IDH1. I am wondering what is the best way to extract the mutations of this gene from these VCF files. Desired output would be a data matrix. Is there a vcf tools can realize this? ...
vcf written 12 weeks ago by ddzhangzz40 • updated 11 weeks ago by Santosh Anand2.3k
0
votes
1
answer
129
views
1
answer
From bam files to isoform read counts
... I downloaded RNASeq bam files from TCGA data portal. I am interested in the expression analysis at isofrom level and wondering how to translate these bam files into counts at each isoform. I have done some analysis at gene level using star or htseq-count but fresh to isoform analysis. Could somebody ...
rna-seq written 3 months ago by ddzhangzz40 • updated 3 months ago by b.nota3.5k
0
votes
1
answer
137
views
1
answers
Comment: C: cutadapt cut the whole sequence from RNASeq fastq file
... Thanks! What do you mean not genomic? How do you know that? ...
written 4 months ago by ddzhangzz40
0
votes
1
answer
137
views
1
answers
Comment: C: cutadapt cut the whole sequence from RNASeq fastq file
... why? if manually remove the adapter `GATCGGAAGAGCACACGTCTGAACTCCAGTCAC` from the seq, the trimmed should be `CGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAACAAAAAAATAAGCAGAGTTGTCAAAGTAAAAACAAAACAAAAAATAATAAGAA`? ...
written 4 months ago by ddzhangzz40

Latest awards to ddzhangzz

Popular Question 15 days ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 7 weeks ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 6 months ago, created a question with more than 1,000 views. For plink analysis including covariates and gxe
Scholar 14 months ago, created an answer that has been accepted. For A: Align RNASeq reads to combined genomes

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1157 users visited in the last hour