User: ddzhangzz

gravatar for ddzhangzz
ddzhangzz40
Reputation:
40
Status:
New User
Location:
United States
Last seen:
1 day, 13 hours ago
Joined:
2 years, 10 months ago
Email:
d********@gmail.com

Posts by ddzhangzz

<prev • 27 results • page 1 of 3 • next >
0
votes
1
answer
93
views
1
answers
Comment: C: cutadapt cut the whole sequence from RNASeq fastq file
... Thanks! What do you mean not genomic? How do you know that? ...
written 5 weeks ago by ddzhangzz40
0
votes
1
answer
93
views
1
answers
Comment: C: cutadapt cut the whole sequence from RNASeq fastq file
... why? if manually remove the adapter `GATCGGAAGAGCACACGTCTGAACTCCAGTCAC` from the seq, the trimmed should be `CGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAACAAAAAAATAAGCAGAGTTGTCAAAGTAAAAACAAAACAAAAAATAATAAGAA`? ...
written 5 weeks ago by ddzhangzz40
0
votes
1
answer
93
views
1
answer
cutadapt cut the whole sequence from RNASeq fastq file
... One of sequences in my RNASeq fastq file looks like: @7001458:226:C989WANXX:3:1102:17546:38724 1:N:0:CGATGT GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAACAAAAAAATAAGCAGAGTTGTCAAAGTAAAAACAAAACAAAAAATAATAAGAA + BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF< ...
rna-seq written 5 weeks ago by ddzhangzz40
0
votes
0
answers
145
views
0
answers
Annotation document for Agilent G4851C (SurePrint G3 Human Gene Expression V3 Microarray Kit )
... I was trying to map Agilent G4851C (Design ID 072363) ProbeID to Entrez ID. I cannot find the annotation specifically for this. I was using hgug4112a.db package in R but only 1/3 can be mapped. I thought it may be an incorrect one. Does somebody know where can I find the annotation for this kit or h ...
microarray written 7 weeks ago by ddzhangzz40
0
votes
1
answer
201
views
1
answers
Comment: C: Alternative splicing analysis of targeted RNASeq data
... Thanks to @EagleEye. but what I am interested is how to do it for targeted RNASeq data in AS analysis (for selected genes). ...
written 7 weeks ago by ddzhangzz40
1
vote
1
answer
201
views
1
answer
Alternative splicing analysis of targeted RNASeq data
... My client has run targeted RNA sequencing for a list of genes from different chromosomes in human and wanted to perform alternative splicing analysis. I have never been working on these type of targeted data analysis and am wondering whether there is standard ways for this analysis. What programs I ...
rna-seq written 8 weeks ago by ddzhangzz40 • updated 7 weeks ago by EagleEye3.4k
1
vote
1
answer
368
views
1
answer
How to link TCGA/GDC HTSeq or FPKM data with clinical data?
... I retrieved FPKM-UQ data (disease=GBM) from TCGA/GDC data portal and am wondering how to link the data with clinical data. The manifest file was looking like this: id filename md5 size state 000e76af-9529-4e0b-b300-c602f5f717d2 b836a8d2-7c37-4af5-9f2f-7bf0121717f9.FPKM-UQ.txt.gz 9e947e2561 ...
rna-seq written 4 months ago by ddzhangzz40 • updated 6 weeks ago by Smandape60
0
votes
0
answers
262
views
0
answers
how to map UCSC isoform id to its isoform symbols?
... I downloaded TCGA RNASeq Data of Isoforms and wanted to know how to map the UCSC isoform IDs to a gene's isoform symbols. Here is an example. Suppose I have the UCSC ids of gene SET: id cds db geneName raw_count scaled_estimate 1 uc004bvt.3 0:04:02 hg19 SET 1152.45 3.14566448 ...
rna-seq written 5 months ago by ddzhangzz40 • updated 4 months ago by Biostar ♦♦ 10
0
votes
1
answer
773
views
1
answers
Comment: C: Calculate the fold change between two groups
... Thanks @Devon Ryan! Would you mind to provide some reference so I can check in details? ...
written 6 months ago by ddzhangzz40
4
votes
1
answer
773
views
1
answer
Calculate the fold change between two groups
... Suppose I have gene expression values (not at log2) at pre and post from 3 patients (these are real values): pre<-c(22.228, 0.002, 0.013) post<-c(0.185, 0.018, 0.009) I am wondering how to calculate the mean fold change between pre and post: #mean of fold change mean(post/p ...
rna-seq written 6 months ago by ddzhangzz40 • updated 6 months ago by Devon Ryan63k

Latest awards to ddzhangzz

Popular Question 3 months ago, created a question with more than 1,000 views. For plink analysis including covariates and gxe
Scholar 11 months ago, created an answer that has been accepted. For A: Align RNASeq reads to combined genomes

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 474 users visited in the last hour