User: ddzhangzz

gravatar for ddzhangzz
ddzhangzz60
Reputation:
60
Status:
Trusted
Location:
United States
Last seen:
2 days, 21 hours ago
Joined:
3 years, 11 months ago
Email:
d********@gmail.com

Posts by ddzhangzz

<prev • 44 results • page 1 of 5 • next >
0
votes
1
answer
120
views
1
answers
Comment: C: how to split a bam file by read prefix
... Thanks but each split file is same as the original in.bam (didn't split the seqs)? ...
written 4 weeks ago by ddzhangzz60
0
votes
1
answer
120
views
1
answer
how to split a bam file by read prefix
... I have a bam file such like this: sample1_100000007 4 * 0 0 * * 0 0 AGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGTGTAGCGGTGAAATGCGTAGATATATGGAGGAACACCGGTGGCGAAAGCGGCTCTCTGGTCTGTAACTGA ...
rna-seq written 4 weeks ago by ddzhangzz60 • updated 4 weeks ago by Pierre Lindenbaum106k
0
votes
1
answer
331
views
1
answers
Comment: C: How has StringTie caculated the transcript coverage?
... ENST00000269305.7 and ENST00000620739.3 are truely identical in exons assembly (even they are assigned to different Ensembl IDs) (probably due to they have differently AA seq). These cases also seem not rare and we found at least "5" duplicated transcripts in one gene. My question was to understand ...
written 12 weeks ago by ddzhangzz60
2
votes
1
answer
331
views
5 follow
1
answer
How has StringTie caculated the transcript coverage?
... Recently I have used Stringtie to compute the reads of RNASeq mapping to transcripts. There are two transcripts of a gene with exactly same length and number of exons (as well as the assembly structure of the two transcripts) and I found the coverages were very different from each other. ##tra ...
rna-seq written 3 months ago by ddzhangzz60 • updated 12 weeks ago by geo.pertea60
2
votes
1
answer
344
views
1
answer
How to download NCBI sequences using a list of Refseq IDs?
... I have a list of Refseq IDs such as: [1] "NM_010220" "NM_001290393" "NM_007743" "NM_175344" "NM_029432" [6] "NM_001111121" "NM_153399" "NM_007592" "NM_181402" "NM_013737" 11] "NM_007737" "NM_029967" "NM_146062" "NM_019477" "NM_172746" 16] "NM_0241 ...
R written 5 months ago by ddzhangzz60
2
votes
1
answer
285
views
1
answer
How to screen TCGA population for a specific mutation using a COSMIC ID
... I am working on a TCGA breast cancer dataset and wanted to check the prevalence of a specific mutation in this population. If I found an interested mutation from COSMIC, I am wondering how I can link or screen this COSMIC ID (e.g. COSM43759) in the TCGA population. Does somebody have experiences on ...
next-gen written 5 months ago by ddzhangzz60 • updated 5 months ago by Kevin Blighe16k
0
votes
1
answer
312
views
1
answers
Comment: C: Why Trimmoatic assign paired sequences to unpaired after adapter trimming
... Thanks for your reply @Brian Bushnell. My sequence length is 151bp and I guess the length may be unlikely below 50bp even after adapter timmimg off. In what reasons do you think the sequence was eliminated? ...
written 6 months ago by ddzhangzz60
0
votes
1
answer
312
views
1
answer
Why Trimmoatic assign paired sequences to unpaired after adapter trimming
... I manually checked the output of the Trimmomatic and was confused that a paired seqs were assigned to unpaired in the output. Here is my Trimmomatic command line: java -Xms8g -jar Trimmomatic.jar PE -threads 6 -phred33 sample1_R1.fastq.gz sample1_R2.fastq.gz sample1_forward_paired.fastq.gz samp ...
rna-seq written 6 months ago by ddzhangzz60
0
votes
0
answers
360
views
0
answers
Trimmomatic: Missing sequence line from record
... My RNASeq data appear about 3% adapter contamination and I was trying to trim them using Trimmomatic (v.0.36) but it seems it doesn't work correctly. I got below message a second after I run the program: TrimmomaticPE: Started with arguments: ...
rna-seq written 8 months ago by ddzhangzz60
0
votes
1
answer
439
views
1
answers
Comment: C: How to subset a UCSC table
... Thanks! It works. Never thought it was caused by name...:(. ...
written 10 months ago by ddzhangzz60

Latest awards to ddzhangzz

Popular Question 8 weeks ago, created a question with more than 1,000 views. For STAR outputs empty alignment
Popular Question 11 weeks ago, created a question with more than 1,000 views. For Should adapters for RNASeq be removed before alignment?
Popular Question 11 weeks ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 10 months ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 11 months ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 16 months ago, created a question with more than 1,000 views. For plink analysis including covariates and gxe
Scholar 2.0 years ago, created an answer that has been accepted. For A: Align RNASeq reads to combined genomes

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1040 users visited in the last hour