User: ddzhangzz

gravatar for ddzhangzz
ddzhangzz90
Reputation:
90
Status:
Trusted
Location:
United States
Last seen:
1 month, 1 week ago
Joined:
6 years, 2 months ago
Email:
d********@gmail.com

Posts by ddzhangzz

<prev • 54 results • page 1 of 6 • next >
1
vote
1
answer
76
views
1
answer
Is it possible to pipelined two picard tools into one input?
... Suppose I have a bam file, `abc.bam`, needs to run `CleanSam` and `SamToFastq`: java -jar picard.jar CleanSam \ I=abc.bam \ O=abc_cleaned.bam \ java -jar picard.jar SamToFastq \ I=abc_cleaned.bam \ FASTQ=R1.fastq \ SECOND_END_FASTQ=R2.fastq Is i ...
next-gen written 5 weeks ago by ddzhangzz90 • updated 5 weeks ago by Pierre Lindenbaum129k
0
votes
0
answers
156
views
0
answers
Comment: C: Strandedness of whole genome sequences?
... CNV should occur on both strands of DNA, so I think it's safe to ignore the strandedness. Am I right? ...
written 8 weeks ago by ddzhangzz90
4
votes
0
answers
156
views
0
answers
Strandedness of whole genome sequences?
... My customer gave me a list of genes with known strand information to check the copy number variation (CNV) using their WGS data. The results of CNV provided the start and end position but not strandedness. I am concerned to link the CNV results with the gene list by ignoring the strandedness. I am w ...
next-gen written 8 weeks ago by ddzhangzz90 • updated 13 days ago by Biostar ♦♦ 20
6
votes
2
answers
372
views
2
answers
How to subset fastq data based on leading nt of sequences?
... I wanted to extract reads from a fastq format file for the reads that the 1-8 nt with a format of "NNNNNGGG" and saved as a fastq file as well for further alignment. for example for the three reads below: @SRR8105603.9 NS500418:833:HNY2CBGX5:1:11101:10498:1122 length=76 GCAGGGGGACCCCATCTCTA ...
rna-seq written 12 months ago by ddzhangzz90 • updated 12 months ago by steve2.6k
0
votes
0
answers
735
views
0
answers
Comment: C: Gatk Mutec2 germline resources for mouse
... I wanted to ask same question, have you get a solution? ...
written 16 months ago by ddzhangzz90
0
votes
0
answers
413
views
0
answers
Comment: C: How does gage test the pathway statistics?
... There is no answer for this question in the manual. ...
written 16 months ago by ddzhangzz90
1
vote
0
answers
413
views
0
answers
How does gage test the pathway statistics?
... Suppose all of log2 fold changes from 1000 genes are negative (down regulated) library(gage) go.set <- go.gsets(species = "human") go.cc.hs <-go.set$go.sets[go.set$go.subs$CC] fcs<- -c(1:1000) set.seeds(123) names(fcs)<-sample(unlist(go.cc.hs), 1000) head(f ...
R bioconductor written 16 months ago by ddzhangzz90 • updated 16 months ago by zx87549.4k
1
vote
0
answers
667
views
0
answers
How to safely rename the chromosome names in fasta and gtf
... I have a fasta with headers such like: >chr1 1 >chr2 2 >chr3 3 >chr4 4 >chr5 5 >chr6 6 >chr7 7 >chr8 8 >chr9 9 >chr10 10 >chr11 11 >chr12 12 >chr13 13 >chr14 14 >chr15 15 >chr16 16 &g ...
rna-seq written 18 months ago by ddzhangzz90
1
vote
1
answer
2.4k
views
1
answer
How to change SM tag in bam file
... I have a bam file with header such like this: @RG ID:S1-L001 LB:L001 PL:Illumina SM:L001 PU:novaSeq @RG ID:S1-L002 LB:L002 PL:Illumina SM:L002 PU:novaSeq This bam file was generated by picard `MergeSamFiles` where one sample library was sequenced in two lanes (L001, L002) but I need to cor ...
next-gen written 2.1 years ago by ddzhangzz90 • updated 2.1 years ago by ATpoint36k
0
votes
1
answer
529
views
1
answer
Is there a way to retrieve peptide motifs based on MAF/VEP output?
... Using the Ensembl's Variant Effect Predictor (VEP) program I evaluated the variants identified form GATK::MuTect2. The output looks like this: Uploaded_variation Location Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position ...
next-gen written 2.2 years ago by ddzhangzz90 • updated 2.2 years ago by Denise CS5.1k

Latest awards to ddzhangzz

Supporter 8 weeks ago, voted at least 25 times.
Epic Question 12 months ago, created a question with more than 10,000 views. For Calculate the fold change between two groups
Popular Question 12 months ago, created a question with more than 1,000 views. For RNASeq with mixed tissues
Popular Question 12 months ago, created a question with more than 1,000 views. For Contrast matrix for paired samples in limma
Popular Question 12 months ago, created a question with more than 1,000 views. For Alternative splicing analysis of targeted RNASeq data
Popular Question 12 months ago, created a question with more than 1,000 views. For RNASeq with mixed tissues
Popular Question 14 months ago, created a question with more than 1,000 views. For RNASeq with mixed tissues
Popular Question 14 months ago, created a question with more than 1,000 views. For RNASeq with mixed tissues
Popular Question 18 months ago, created a question with more than 1,000 views. For STAR outputs empty alignment
Popular Question 18 months ago, created a question with more than 1,000 views. For RNASeq with mixed tissues
Popular Question 23 months ago, created a question with more than 1,000 views. For STAR outputs empty alignment
Popular Question 23 months ago, created a question with more than 1,000 views. For RNASeq with mixed tissues
Popular Question 23 months ago, created a question with more than 1,000 views. For Contrast matrix for paired samples in limma
Popular Question 23 months ago, created a question with more than 1,000 views. For Should adapters for RNASeq be removed before alignment?
Student 23 months ago, asked a question with at least 3 up-votes. For How has StringTie caculated the transcript coverage?
Great Question 23 months ago, created a question with more than 5,000 views. For Calculate the fold change between two groups
Popular Question 2.0 years ago, created a question with more than 1,000 views. For STAR outputs empty alignment
Popular Question 2.2 years ago, created a question with more than 1,000 views. For STAR outputs empty alignment
Popular Question 2.3 years ago, created a question with more than 1,000 views. For STAR outputs empty alignment
Popular Question 2.5 years ago, created a question with more than 1,000 views. For STAR outputs empty alignment
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Should adapters for RNASeq be removed before alignment?
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 3.3 years ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 3.7 years ago, created a question with more than 1,000 views. For plink analysis including covariates and gxe

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 926 users visited in the last hour