User: ddzhangzz

gravatar for ddzhangzz
ddzhangzz40
Reputation:
40
Status:
New User
Location:
United States
Last seen:
21 hours ago
Joined:
3 years, 5 months ago
Email:
d********@gmail.com

Posts by ddzhangzz

<prev • 38 results • page 1 of 4 • next >
0
votes
1
answer
148
views
1
answers
Comment: C: Why Trimmoatic assign paired sequences to unpaired after adapter trimming
... Thanks for your reply @Brian Bushnell. My sequence length is 151bp and I guess the length may be unlikely below 50bp even after adapter timmimg off. In what reasons do you think the sequence was eliminated? ...
written 11 days ago by ddzhangzz40
0
votes
1
answer
148
views
1
answer
Why Trimmoatic assign paired sequences to unpaired after adapter trimming
... I manually checked the output of the Trimmomatic and was confused that a paired seqs were assigned to unpaired in the output. Here is my Trimmomatic command line: java -Xms8g -jar Trimmomatic.jar PE -threads 6 -phred33 sample1_R1.fastq.gz sample1_R2.fastq.gz sample1_forward_paired.fastq.gz samp ...
rna-seq written 11 days ago by ddzhangzz40
0
votes
0
answers
155
views
0
answers
Trimmomatic: Missing sequence line from record
... My RNASeq data appear about 3% adapter contamination and I was trying to trim them using Trimmomatic (v.0.36) but it seems it doesn't work correctly. I got below message a second after I run the program: TrimmomaticPE: Started with arguments: ...
rna-seq written 8 weeks ago by ddzhangzz40
0
votes
1
answer
223
views
1
answers
Comment: C: How to subset a UCSC table
... Thanks! It works. Never thought it was caused by name...:(. ...
written 4 months ago by ddzhangzz40
0
votes
1
answer
223
views
1
answers
Comment: C: How to subset a UCSC table
... $ ll /data/projects/JingChen-TCGA/Alternative_splicing/Data/UCSC/local total 8 -rw-r--r-- 1 3849 Jun 8 14:20 TP53-ensGene.txt -rw-r--r-- 1 4015 Jun 8 11:21 TP53-Homo_sapiens_Transcript_Summary.txt ...
written 4 months ago by ddzhangzz40
2
votes
1
answer
223
views
1
answer
How to subset a UCSC table
... I downloaded `ensGene.txt` file from [UCSC here][1] and wanted to create custom GFF annotation for [MISO][2]. I can generate the GFF annotation using the entire ensGene.txt file but I am only interested to generate for a small subset. Then I create a subset by grep such like: $grep ENSG00000141 ...
assembly written 4 months ago by ddzhangzz40
0
votes
1
answer
172
views
1
answers
Comment: C: Check the DNA strands source information of paired RNA-Seq fastq data
... Thanks @Devon Ryan! Could you have some explanation of the -f and -F options? And I got same numbers from my case: samtools view -c -f 32 -F 256 C92LDANXX_s8_1_B01_0249_SL152940Aligned.out.bam 19770944 samtools view -c -f 16 -F 256 C92LDANXX_s8_1_B01_0249_SL152940Aligned.out.bam 1 ...
written 5 months ago by ddzhangzz40
3
votes
1
answer
172
views
1
answer
Check the DNA strands source information of paired RNA-Seq fastq data
... I would like to check which DNA strands where my RNASeq have come from. I checked a couple of them by browsing UCSC: R1 Read: @HISEQ-WALDORF:249:C92LDANXX:8:1101:3161:1988 NTCGAGACTTCTTATAATTTGCATAATCCTCCAAAATGGAATCCACATTCTTCTTGGCAGGAAGATAAAAAAGCTGCTTCTGTCTGGTGATCAAGTCCCAGTCATCCACAAGCCAGGG ...
rna-seq written 5 months ago by ddzhangzz40 • updated 5 months ago by Devon Ryan71k
5
votes
1
answer
174
views
1
answer
Quick check of the RNASeq length for a bunch of files
... I have >500 fastq.gz files from a RNASeq project and was told they have been run with either 125bp or 50bp. I am wondering if there is a quick way to check which files are 125bp and which are 50bp. One file seems not bad to check but for 500 files I wanted to find a better way. ...
rna-seq written 6 months ago by ddzhangzz40 • updated 6 months ago by genomax34k
3
votes
2
answers
402
views
5 follow
2
answers
Extract mutations for a specific gene from a vcf file
... I downloaded more than 4000+ VCF files from TCGA but I am only interested in mutations of one gene, IDH1. I am wondering what is the best way to extract the mutations of this gene from these VCF files. Desired output would be a data matrix. Is there a vcf tools can realize this? ...
vcf written 6 months ago by ddzhangzz40 • updated 6 months ago by Santosh Anand3.0k

Latest awards to ddzhangzz

Popular Question 4 months ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 5 months ago, created a question with more than 1,000 views. For Calculate the fold change between two groups
Popular Question 10 months ago, created a question with more than 1,000 views. For plink analysis including covariates and gxe
Scholar 18 months ago, created an answer that has been accepted. For A: Align RNASeq reads to combined genomes

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1390 users visited in the last hour