User: ddzhangzz

gravatar for ddzhangzz
ddzhangzz20
Reputation:
20
Status:
New User
Location:
United States
Last seen:
41 minutes ago
Joined:
2 years, 8 months ago
Email:
d********@gmail.com

Posts by ddzhangzz

<prev • 21 results • page 1 of 3 • next >
0
votes
0
answers
191
views
0
answers
How to link TCGA/GDC HTSeq or FPKM data with clinical data?
... I retrieved FPKM-UQ data (disease=GBM) from TCGA/GDC data portal and am wondering how to link the data with clinical data. The manifest file was looking like this: id filename md5 size state 000e76af-9529-4e0b-b300-c602f5f717d2 b836a8d2-7c37-4af5-9f2f-7bf0121717f9.FPKM-UQ.txt.gz 9e947e2561 ...
rna-seq written 9 weeks ago by ddzhangzz20 • updated 9 days ago by Biostar ♦♦ 10
0
votes
0
answers
188
views
0
answers
how to map UCSC isoform id to its isoform symbols?
... I downloaded TCGA RNASeq Data of Isoforms and wanted to know how to map the UCSC isoform IDs to a gene's isoform symbols. Here is an example. Suppose I have the UCSC ids of gene SET: id cds db geneName raw_count scaled_estimate 1 uc004bvt.3 0:04:02 hg19 SET 1152.45 3.14566448 ...
rna-seq written 3 months ago by ddzhangzz20 • updated 8 weeks ago by Biostar ♦♦ 10
0
votes
1
answer
533
views
1
answers
Comment: C: Calculate the fold change between two groups
... Thanks @Devon Ryan! Would you mind to provide some reference so I can check in details? ...
written 4 months ago by ddzhangzz20
4
votes
1
answer
533
views
1
answer
Calculate the fold change between two groups
... Suppose I have gene expression values (not at log2) at pre and post from 3 patients (these are real values): pre<-c(22.228, 0.002, 0.013) post<-c(0.185, 0.018, 0.009) I am wondering how to calculate the mean fold change between pre and post: #mean of fold change mean(post/p ...
rna-seq written 4 months ago by ddzhangzz20 • updated 4 months ago by Devon Ryan60k
0
votes
1
answer
266
views
1
answers
Comment: C: Should I trim adapter for single-end RNASeq reads?
... Thanks @Devon. The sequencing center gave me two adapter sequences: >TruSeq_Universal_Adapter AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT >TruSeq_Adapter_Index_1 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG I am wondering why there are two a ...
written 4 months ago by ddzhangzz20
3
votes
1
answer
266
views
1
answer
Should I trim adapter for single-end RNASeq reads?
... In my knowledge, it is necessary to check and trim adapters for paired-end RNASeq reads because some inserts might be too short and that leads to adapters being sequenced into reads. But for single end, it seems not necessary because there is no way to sequence to adapter. Is this right? ...
rna-seq written 4 months ago by ddzhangzz20 • updated 4 months ago by Devon Ryan60k
0
votes
0
answers
383
views
0
answers
Comment: C: STAR outputs empty alignment
... My purpose was not only trying to align sequences to short barcodes but also comparing the STAR program with Bowtie2. I have done this process using Bowtie2 but got this issue from STAR program. ...
written 7 months ago by ddzhangzz20
2
votes
0
answers
383
views
0
answers
STAR outputs empty alignment
... My job was not a regular sequence to genome alignment but I was trying to use STAR to accomplish it. Here is the stiuation: I have a reference "genome" comprised of 12415 barcodes with fixed length 18 bp each. And the sequences that I was trying to alignment to this "genome" are 900,000 sequences al ...
alignment sequence written 7 months ago by ddzhangzz20
3
votes
1
answer
247
views
1
answer
bowtie2 output only valid alignments
... I was trying to align paired end RNASeq data to a locally-built reference using bowtie2: $bowtie2 --trim3 0 --threads 6 --no-discordant --no-mixed -k 1 \ -x $idx -1 $f1 -2 $f2 -S classI.sam And the sam file output looks like this (ignored the header): ERR356371.7445 141 * 0 0 * * ...
rna-seq written 8 months ago by ddzhangzz20
0
votes
0
answers
395
views
0
answers
Comment: C: How to divide the reference sequence into batches or chunks
... Thanks, very helpful! ...
written 9 months ago by ddzhangzz20

Latest awards to ddzhangzz

Popular Question 7 weeks ago, created a question with more than 1,000 views. For plink analysis including covariates and gxe
Scholar 9 months ago, created an answer that has been accepted. For A: Align RNASeq reads to combined genomes

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1554 users visited in the last hour