User: lilla.davim

gravatar for lilla.davim
lilla.davim130
Reputation:
130
Status:
Trusted
Location:
France
Last seen:
5 years, 8 months ago
Joined:
5 years, 9 months ago
Email:
l**********@gmail.com

Posts by lilla.davim

<prev • 13 results • page 1 of 2 • next >
4
votes
1
answer
2.0k
views
1
answer
UCSC Table Browser: redundant CDS sequences in generated fasta
... Hello, I used UCSC Table Browser to generate a fasta where each entry is a CDS within a given region. The parameters I used are the following: group: Genes and gene predictions track: Ensembl genes table: ensGene region: position chr20:250000-1000000 output format: sequence output file: myf ...
table browser cds ucsc written 5.7 years ago by lilla.davim130 • updated 5.7 years ago by Bert Overduin3.7k
0
votes
2
answers
14k
views
2
answers
Comment: C: Still confused about exons versus CDS
... Hello, Thanks a lot for your reply, which makes things much clearer now. The only thing which actually remains completely unclear is UCSC's  rationale for implementing things this way! Btw is there any other method (using UCSC, Ensembl or else) to generate, for a given sequence in an assembly (GRCh ...
written 5.8 years ago by lilla.davim130
0
votes
2
answers
14k
views
2
answers
Comment: A: Still confused about exons versus CDS
... Here is an example in the 1st entry of the following fasta, which goes from lower to upper case. All other parameters are the same, only the display options are different: With option 1: http://genome.ucsc.edu/cgi-bin/hgc?hgsid=381409833_XLyyszThcNrKOH4dtiDua1kPTT1k&g=htcDnaNearGene&i=uc00 ...
written 5.8 years ago by lilla.davim130
0
votes
2
answers
14k
views
2
answers
Comment: A: Still confused about exons versus CDS
... Hello Adrian, Ok so your definitions correspond to mine, i.e., CDS are included in exons. You could be looking at something with very small Introns and large UTRs, in which case option 2 will have more lower case than option 1. I guess option 2 should always have more (or equal) lower case bases ...
written 5.8 years ago by lilla.davim130
16
votes
2
answers
14k
views
8 follow
2
answers
Still confused about exons versus CDS
... Hello, I thought I had understood the difference between the 2 terms but I am afraid I still need a clear explanation. Is the following correct? Exon: A sequence which remains present in a mature RNA. CDS: A sequence which remains present in a mature RNA and codes for a protein (i.e. gets trans ...
cds exon written 5.8 years ago by lilla.davim130 • updated 5.8 years ago by Bert Overduin3.7k
1
vote
3
answers
5.2k
views
3
answers
Comment: A: dbSNP not using hg19?
... I see, thanks a lot. And is there a way to query directly older builds of dbSNP based on hg19, or do I necessarily need to go through an intermediary mapping step between the 2 reference assemblies (e.g. using UCSC liftOver tool)? I have namely I list of potential variants described with hg19 posit ...
written 5.8 years ago by lilla.davim130
7
votes
3
answers
5.2k
views
3
answers
dbSNP not using hg19?
... Hello, I looked in dbSNP (http://www.ncbi.nlm.nih.gov/snp) for existing variants in the interval chr20:256720-256730.  There is one match at position ch20:256722. The corresponding sequence displayed is the following:  GAAAGGATTCTGGAAAAGTGAGCTG[G/T]AACAGAAAAGAACTGTCTCAATGGG However when I look a ...
snp written 5.8 years ago by lilla.davim130 • updated 5.8 years ago by enricoferrero790
0
votes
2
answers
5.6k
views
2
answers
Comment: A: Reference transcriptome ?
... Hello, Thanks but in the UCSC Table Browser if I select: Table: Groups and group predictions Track: GENCODE Genes V19 Table: Basic (wgEncodeGencodeBasicV19) Then I where do I specify that I want RNAs (i.e. sequence of the transcriptome)? ...
written 5.8 years ago by lilla.davim130
12
votes
5
answers
4.3k
views
5
answers
Efficient Python data structure to store and process annotations
... Hello, For a set of patients, I need to store in Python a set of annotations corresponding to a (potentially very large) set of positions (quite similar to a VCF file for each patient), and I am looking for a Python data structure that takes minimal space and can efficiently be queried (by position ...
python annotations written 5.8 years ago by lilla.davim130 • updated 5.8 years ago by Alex Reynolds29k
0
votes
2
answers
5.6k
views
2
answers
Comment: A: Reference transcriptome ?
... Ok thanks, so I guess to get the transcriptome I need to select: group = mRNA and EST track = human mRNAs table = all_mrna region = genome This however gives me only the mRNAs, and I thought a transcriptome also included other types of RNAs. Is this wrong? If not I did not see how I could ge ...
written 5.8 years ago by lilla.davim130

Latest awards to lilla.davim

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2160 users visited in the last hour