User: illinois.ks

gravatar for illinois.ks
illinois.ks160
Reputation:
160
Status:
Trusted
Location:
Korea, Republic Of
Last seen:
1 year, 3 months ago
Joined:
6 years, 1 month ago
Email:
i**********@gmail.com

Posts by illinois.ks

<prev • 63 results • page 1 of 7 • next >
4
votes
1
answer
452
views
1
answer
RNA-seq analysis design
... Dear all, I am analysing our RNA-seq data to find DEG responding our drug combinations and have a few questions. I have 4 conditions and per each condition I have 3 replicates group 1. Control (3 replicates) group 2. Disease model (3 replicates) group 3. Disease model + 1 drugs ( 3 re ...
rna-seq written 16 months ago by illinois.ks160 • updated 16 months ago by Devon Ryan96k
0
votes
0
answers
627
views
0
answers
microRNA data analysis
... Hello, While I am analysing microRNA data (bowtie2-htseq-count pipeline), I had a question! ( trim the adapter sequence, mapping with bowtie2) When, I aligned my sequence data, I have used the DEseq to call the DEGs. I have two replicates for each of two comparision, which leads to the total of ...
R rna-seq written 23 months ago by illinois.ks160 • updated 23 months ago by zx87549.4k
9
votes
3
answers
6.1k
views
3
answers
large insertion/deletion detection from NGS data
... Dear all, I am struggling with identification of large insertion/deletion as well as variants calls. I have used the GATK for snps call s and realized that GATK tools identified up to 50bp(?) insertion/deletion as well as SNPs.  However  I am wondering whether I could also detect the large size in ...
indel gatk insertion deletion written 5.0 years ago by illinois.ks160 • updated 5.0 years ago by Brian Bushnell17k
0
votes
1
answer
1.7k
views
1
answers
Comment: C: analysis of deletion/insertion from mitochondria NGS data
... .. duplicated post  ...
written 5.0 years ago by illinois.ks160
0
votes
1
answer
1.7k
views
1
answers
Comment: C: analysis of deletion/insertion from mitochondria NGS data
... Thank you Fidel.  I have run bowtie2 to map the mitochondria gene.  In this case, I have used whole genome  fasta file and gtf file. (I am not sure whether it is right or not. I meant that I have to use only the mitochondria genome instead of whole genome for mapping..)    Here is the result of ...
written 5.0 years ago by illinois.ks160
2
votes
1
answer
1.7k
views
1
answer
analysis of deletion/insertion from mitochondria NGS data
... Hello, I am trying to map the human mitochondria genome and try to find large insertion/deletion (> larger than 10 bps). I have paired-end fastq file of mitochondria genome using NGS.. It is the first time for me to do it. COuld you please let me know the procedure for it? Maybe, I am thinking ...
mitochondria genome; insertion/deletion written 5.0 years ago by illinois.ks160 • updated 5.0 years ago by Fidel1.9k
0
votes
1
answer
2.0k
views
1
answers
Comment: C: Find the mapped read sequences to a specific gene from bam file
... thank you so much! :)  ...
written 5.1 years ago by illinois.ks160
0
votes
1
answer
2.0k
views
1
answers
Comment: C: Find the mapped read sequences to a specific gene from bam file
... Thank you  so much..  I see by looking at the real sequences, we can see it comes from 320-3p....  I know mir-320-5p  gccuucucuucccgguucuucc mir-320-3p aaaagcuggguugagagggcga ==================== As you said, if my reads are mapped to miRNA-320-3p, then, I need to only find targets of mir-32 ...
written 5.1 years ago by illinois.ks160
0
votes
1
answer
2.0k
views
1
answers
Comment: C: Find the mapped read sequences to a specific gene from bam file
... Hello,    I have used following command as you suggested. However, Still have no idea to figure out it tit 3p or 5p. > samtools view -h C1_whole_mmu_sorted.bam chr14:70443510-70443591 > out.sam that region(chr14:70443510-70443591) was indicated by mir-320 region. (http://www.mirbase.org/c ...
written 5.1 years ago by illinois.ks160
3
votes
1
answer
2.0k
views
1
answer
Find the mapped read sequences to a specific gene from bam file
... Hello all, I would like to see the all read sequences which are mappped to specific miRNA (e.g. mmu-mir-320, mmu-mir-32) Since I would like to check whether my miRNAs comes from 3p- or 5p-.  https://www.biostars.org/p/150526/#150640 I guess I can use samtools but I am not sure how I can exactly d ...
samtools written 5.1 years ago by illinois.ks160

Latest awards to illinois.ks

Epic Question 16 months ago, created a question with more than 10,000 views. For convert bam file to raw read count file for DESeq or EdgeR
Appreciated 23 months ago, created a post with more than 5 votes. For miRNA mapping rate is very low.. (less than 0.03%)
Great Question 23 months ago, created a question with more than 5,000 views. For GSEA analysis with Mouse (Please give some comments..)
Popular Question 23 months ago, created a question with more than 1,000 views. For Find the mapped read sequences to a specific gene from bam file
Great Question 5.0 years ago, created a question with more than 5,000 views. For GSEA analysis with Mouse (Please give some comments..)
Great Question 5.0 years ago, created a question with more than 5,000 views. For convert bam file to raw read count file for DESeq or EdgeR
Popular Question 5.0 years ago, created a question with more than 1,000 views. For Find the mapped read sequences to a specific gene from bam file
Popular Question 5.0 years ago, created a question with more than 1,000 views. For Differentially expressed microRNA analysis using bowtie2-cufflink-cuffdiff
Popular Question 5.0 years ago, created a question with more than 1,000 views. For Called variants in VCF file are mapped to untarged regions.. Does it make sense?
Popular Question 5.0 years ago, created a question with more than 1,000 views. For In tophat-cufflink-cuffmerge pipeline, order of gtf file in assembles.txt file
Popular Question 5.0 years ago, created a question with more than 1,000 views. For Annotation of miRNA from NGS
Popular Question 5.0 years ago, created a question with more than 1,000 views. For GSEA analysis with Mouse (Please give some comments..)
Popular Question 5.0 years ago, created a question with more than 1,000 views. For GLM model design question
Popular Question 5.0 years ago, created a question with more than 1,000 views. For how to decide whether intercept term is necessary for GLM model or not
Popular Question 5.0 years ago, created a question with more than 1,000 views. For Differentially Expressed miRNA analysis : DEseq VS. Cuffdiff
Popular Question 5.0 years ago, created a question with more than 1,000 views. For From fastq file to vcf file (inconsistent vcf file from two methods)
Popular Question 5.0 years ago, created a question with more than 1,000 views. For large insertion/deletion detection from NGS data
Popular Question 5.0 years ago, created a question with more than 1,000 views. For convert bam file to raw read count file for DESeq or EdgeR
Popular Question 5.0 years ago, created a question with more than 1,000 views. For analysis of deletion/insertion from mitochondria NGS data
Popular Question 5.0 years ago, created a question with more than 1,000 views. For variant calling in Illumina miSeq
Popular Question 5.0 years ago, created a question with more than 1,000 views. For miRNA mapping rate is very low.. (less than 0.03%)
Popular Question 5.0 years ago, created a question with more than 1,000 views. For microRNA target finding : 3p vs 5p?
Student 5.0 years ago, asked a question with at least 3 up-votes. For miRNA mapping rate is very low.. (less than 0.03%)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1047 users visited in the last hour