User: illinois.ks

gravatar for illinois.ks
Korea, Republic Of
Last seen:
10 months ago
5 years, 8 months ago

Posts by illinois.ks

<prev • 63 results • page 1 of 7 • next >
RNA-seq analysis design
... Dear all, I am analysing our RNA-seq data to find DEG responding our drug combinations and have a few questions. I have 4 conditions and per each condition I have 3 replicates group 1. Control (3 replicates) group 2. Disease model (3 replicates) group 3. Disease model + 1 drugs ( 3 re ...
rna-seq written 10 months ago by illinois.ks160 • updated 10 months ago by Devon Ryan94k
microRNA data analysis
... Hello, While I am analysing microRNA data (bowtie2-htseq-count pipeline), I had a question! ( trim the adapter sequence, mapping with bowtie2) When, I aligned my sequence data, I have used the DEseq to call the DEGs. I have two replicates for each of two comparision, which leads to the total of ...
R rna-seq written 17 months ago by illinois.ks160 • updated 17 months ago by zx87549.0k
large insertion/deletion detection from NGS data
... Dear all, I am struggling with identification of large insertion/deletion as well as variants calls. I have used the GATK for snps call s and realized that GATK tools identified up to 50bp(?) insertion/deletion as well as SNPs.  However  I am wondering whether I could also detect the large size in ...
indel gatk insertion deletion written 4.5 years ago by illinois.ks160 • updated 4.5 years ago by Brian Bushnell17k
Comment: C: analysis of deletion/insertion from mitochondria NGS data
... .. duplicated post  ...
written 4.6 years ago by illinois.ks160
Comment: C: analysis of deletion/insertion from mitochondria NGS data
... Thank you Fidel.  I have run bowtie2 to map the mitochondria gene.  In this case, I have used whole genome  fasta file and gtf file. (I am not sure whether it is right or not. I meant that I have to use only the mitochondria genome instead of whole genome for mapping..)    Here is the result of ...
written 4.6 years ago by illinois.ks160
analysis of deletion/insertion from mitochondria NGS data
... Hello, I am trying to map the human mitochondria genome and try to find large insertion/deletion (> larger than 10 bps). I have paired-end fastq file of mitochondria genome using NGS.. It is the first time for me to do it. COuld you please let me know the procedure for it? Maybe, I am thinking ...
mitochondria genome; insertion/deletion written 4.6 years ago by illinois.ks160 • updated 4.6 years ago by Fidel1.9k
Comment: C: Find the mapped read sequences to a specific gene from bam file
... thank you so much! :)  ...
written 4.6 years ago by illinois.ks160
Comment: C: Find the mapped read sequences to a specific gene from bam file
... Thank you  so much..  I see by looking at the real sequences, we can see it comes from 320-3p....  I know mir-320-5p  gccuucucuucccgguucuucc mir-320-3p aaaagcuggguugagagggcga ==================== As you said, if my reads are mapped to miRNA-320-3p, then, I need to only find targets of mir-32 ...
written 4.6 years ago by illinois.ks160
Comment: C: Find the mapped read sequences to a specific gene from bam file
... Hello,    I have used following command as you suggested. However, Still have no idea to figure out it tit 3p or 5p. > samtools view -h C1_whole_mmu_sorted.bam chr14:70443510-70443591 > out.sam that region(chr14:70443510-70443591) was indicated by mir-320 region. ( ...
written 4.6 years ago by illinois.ks160
Find the mapped read sequences to a specific gene from bam file
... Hello all, I would like to see the all read sequences which are mappped to specific miRNA (e.g. mmu-mir-320, mmu-mir-32) Since I would like to check whether my miRNAs comes from 3p- or 5p-. I guess I can use samtools but I am not sure how I can exactly d ...
samtools written 4.6 years ago by illinois.ks160

Latest awards to illinois.ks

Epic Question 10 months ago, created a question with more than 10,000 views. For convert bam file to raw read count file for DESeq or EdgeR
Appreciated 17 months ago, created a post with more than 5 votes. For miRNA mapping rate is very low.. (less than 0.03%)
Great Question 17 months ago, created a question with more than 5,000 views. For GSEA analysis with Mouse (Please give some comments..)
Popular Question 17 months ago, created a question with more than 1,000 views. For Find the mapped read sequences to a specific gene from bam file
Great Question 4.5 years ago, created a question with more than 5,000 views. For GSEA analysis with Mouse (Please give some comments..)
Great Question 4.5 years ago, created a question with more than 5,000 views. For convert bam file to raw read count file for DESeq or EdgeR
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Find the mapped read sequences to a specific gene from bam file
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Differentially expressed microRNA analysis using bowtie2-cufflink-cuffdiff
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Called variants in VCF file are mapped to untarged regions.. Does it make sense?
Popular Question 4.5 years ago, created a question with more than 1,000 views. For In tophat-cufflink-cuffmerge pipeline, order of gtf file in assembles.txt file
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Annotation of miRNA from NGS
Popular Question 4.5 years ago, created a question with more than 1,000 views. For GSEA analysis with Mouse (Please give some comments..)
Popular Question 4.5 years ago, created a question with more than 1,000 views. For GLM model design question
Popular Question 4.5 years ago, created a question with more than 1,000 views. For how to decide whether intercept term is necessary for GLM model or not
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Differentially Expressed miRNA analysis : DEseq VS. Cuffdiff
Popular Question 4.5 years ago, created a question with more than 1,000 views. For From fastq file to vcf file (inconsistent vcf file from two methods)
Popular Question 4.5 years ago, created a question with more than 1,000 views. For large insertion/deletion detection from NGS data
Popular Question 4.5 years ago, created a question with more than 1,000 views. For convert bam file to raw read count file for DESeq or EdgeR
Popular Question 4.5 years ago, created a question with more than 1,000 views. For analysis of deletion/insertion from mitochondria NGS data
Popular Question 4.5 years ago, created a question with more than 1,000 views. For variant calling in Illumina miSeq
Popular Question 4.5 years ago, created a question with more than 1,000 views. For miRNA mapping rate is very low.. (less than 0.03%)
Popular Question 4.5 years ago, created a question with more than 1,000 views. For microRNA target finding : 3p vs 5p?
Student 4.5 years ago, asked a question with at least 3 up-votes. For miRNA mapping rate is very low.. (less than 0.03%)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1248 users visited in the last hour