User: halima.loulou

New User
Last seen:
3 years, 1 month ago
4 years, 1 month ago

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by halima.loulou

<prev • 6 results • page 1 of 1 • next >
(Closed) get homologuos for a gene
... how can I Find a homolog for a gene in another organism in biopython???? ...
homologuos organism biopython written 4.1 years ago by halima.loulou0
Comment: C: blast against genomes in biopython
... in blast interface i get a result... the sequence is actually a sequence of Beutenbergia cavernae DSM 12333 genome.. when i remove entrez_query it return result... i thing the entrz_query is wrong.. ...
written 4.1 years ago by halima.loulou0
(Closed) blast against genomes in biopython
... from Bio import Entrez, SeqIO from Bio.Blast import NCBIXML from Bio.Blast import NCBIWWW result_handle = NCBIWWW.qblast("blastn","nr", "CACTTATTTAGTTAGCTTGCAACCCTGGATTTTTGTTTACTGGAGAGGCC",entrez_query='"Beutenbergia cavernae DSM 12333" [Organism]') blast_records = NCBIXML.parse(result_handle) ...
genome biopython blast qblast written 4.1 years ago by halima.loulou0
Comment: C: extract sequence from genome based on homologues with a sequence
... I try to blast the sequence with the entire genome of organism and choose the sequence that has highest score ...
written 4.1 years ago by halima.loulou0
Comment: C: extract sequence from genome based on homologues with a sequence
... I want to extract the sequence with the highest score... ...
written 4.1 years ago by halima.loulou0
extract sequence from genome based on homologues with a sequence
... I have a sequence that have homologous in some species and the score of this homologue.. ex: this is a record from the gff file: 4592637 Beutenbergia_cavernae_DSM_12333 TILL 70731 70780 . 0 . clst_id=429;SubjectOrganism=Thermofilum_pendens_Hrk_5;SubjectScore=0.343373493975904;SubjectO ...
genome homologues sequence extract biopython written 4.1 years ago by halima.loulou0

Latest awards to halima.loulou

No awards yet. Soon to come :-)


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 836 users visited in the last hour