User: halima.loulou

Reputation:
0
Status:
New User
Last seen:
2 years, 5 months ago
Joined:
3 years, 5 months ago
Email:
h************@hotmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by halima.loulou

<prev • 6 results • page 1 of 1 • next >
0
votes
0
answers
654
views
0
answers
(Closed) get homologuos for a gene
... how can I Find a homolog for a gene in another organism in biopython???? ...
homologuos organism biopython written 3.4 years ago by halima.loulou0
0
votes
0
answers
1.5k
views
0
answers
Comment: C: blast against genomes in biopython
... in blast interface i get a result... the sequence is actually a sequence of Beutenbergia cavernae DSM 12333 genome.. when i remove entrez_query it return result... i thing the entrz_query is wrong.. ...
written 3.4 years ago by halima.loulou0
0
votes
0
answers
1.5k
views
0
answers
(Closed) blast against genomes in biopython
... from Bio import Entrez, SeqIO from Bio.Blast import NCBIXML from Bio.Blast import NCBIWWW result_handle = NCBIWWW.qblast("blastn","nr", "CACTTATTTAGTTAGCTTGCAACCCTGGATTTTTGTTTACTGGAGAGGCC",entrez_query='"Beutenbergia cavernae DSM 12333" [Organism]') blast_records = NCBIXML.parse(result_handle) ...
genome biopython blast qblast written 3.4 years ago by halima.loulou0
0
votes
0
answers
650
views
0
answers
Comment: C: extract sequence from genome based on homologues with a sequence
... I try to blast the sequence with the entire genome of organism and choose the sequence that has highest score ...
written 3.4 years ago by halima.loulou0
0
votes
0
answers
650
views
0
answers
Comment: C: extract sequence from genome based on homologues with a sequence
... I want to extract the sequence with the highest score... ...
written 3.4 years ago by halima.loulou0
1
vote
0
answers
650
views
0
answers
extract sequence from genome based on homologues with a sequence
... I have a sequence that have homologous in some species and the score of this homologue.. ex: this is a record from the gff file: 4592637 Beutenbergia_cavernae_DSM_12333 TILL 70731 70780 . 0 . clst_id=429;SubjectOrganism=Thermofilum_pendens_Hrk_5;SubjectScore=0.343373493975904;SubjectO ...
genome homologues sequence extract biopython written 3.4 years ago by halima.loulou0

Latest awards to halima.loulou

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1024 users visited in the last hour