User: bioinformaticssrm2011

Last seen:
7 months, 1 week ago
5 years, 9 months ago

Posts by bioinformaticssrm2011

<prev • 45 results • page 1 of 5 • next >
Comment: C: Linux for loop for 2 inputs and 4 outputs for Trimmomatic fastq quality trimming
... I know its a bit late. But above script won't be able to distinguish between lets say sample1_R1.fastq and sample12_R1.fastq. Above script might get confused whether to select sample1 and sample12. ...
written 3.3 years ago by bioinformaticssrm201190
Comment: C: Using trimmomatic on multiple paired-end read files
... hi, When I was trying to use above script, I got an error. #! python import os import sys import subprocess inputdirectory = "/home/shashank/Desktop/patel_chest_NSC/inputdirectory" processed = "/home/shashank/Desktop/patel_chest_NSC/processed" ...
written 3.3 years ago by bioinformaticssrm201190
Comment: C: Using trimmomatic on multiple paired-end read files
... Thats helpful. but another error pop up- Traceback (most recent call last): File "", line 6, in for fileR1 in os.listdir(inputfile): NameError: name 'inputfile' is not defined ...
written 3.3 years ago by bioinformaticssrm201190
Comment: C: Using trimmomatic on multiple paired-end read files
... About echo, I am new to this, so unable to understand it. Sorry ...
written 3.3 years ago by bioinformaticssrm201190
Comment: C: Using trimmomatic on multiple paired-end read files
... I got an error, if you see that thread ...
written 3.3 years ago by bioinformaticssrm201190
Comment: C: Using trimmomatic on multiple paired-end read files
... Hi, thanks for your help. But I got an error File "", line 8 if ("R1" in fileR1): ^ IndentationError: unindent does not match any outer indentation level than I checked the indent and tried to solve it, and later I got another error- Traceback (most recent ca ...
written 3.3 years ago by bioinformaticssrm201190
Comment: C: rename mutiple fasta header for mutiple fasta files
... Thank you Pierre. It works. ...
written 3.3 years ago by bioinformaticssrm201190
Comment: C: rename mutiple fasta header for mutiple fasta files
... I understand, but I was not able to use the script mentioned there for my work. Though I appreciate there help. ...
written 3.3 years ago by bioinformaticssrm201190
6 follow
rename mutiple fasta header for mutiple fasta files
... Hi, I have mutiple fasta file and I want to change the header, for this I am using - awk '/^>/{print ">C1_" ++i; next}{print}' C1_pandaseq.fasta > C1_pandaseq_new.fasta input fasta- >M03419:60:656544:1:1101:25150:3877:1 CCTACGGGTGGCTGCAGTGGGGAATTTTGGACAA >M03419:60 ...
genome next-gen sequence sequencing written 3.3 years ago by bioinformaticssrm201190 • updated 3.3 years ago by shenwei3565.2k
7 follow
Using trimmomatic on multiple paired-end read files
... I need help to write a for loop to run Trimmomatic tool for quality trimming of paired end fastq files. I need to write a for loop so that I can run an executable for all multiple files. Input PE files looks like - C1_R1.fastq C1_R2.fastq C2_R1.fastq C2_R2.fastq C3_R1.fastq C3_R2.fastq T1_R1 ...
genome assembly ngs next-gen sequencing written 3.3 years ago by bioinformaticssrm201190 • updated 12 months ago by lakhujanivijay5.0k

Latest awards to bioinformaticssrm2011

Great Question 3.3 years ago, created a question with more than 5,000 views. For List of bioinformatics journal with imapact factor around 1 and no publication fee
Great Question 3.3 years ago, created a question with more than 5,000 views. For tree obtained from neighbor-joining and maximum-likelihood are different.
Great Question 3.3 years ago, created a question with more than 5,000 views. For transcription factor binding site prediction software/server
Popular Question 3.3 years ago, created a question with more than 1,000 views. For Protein sequence analysis
Popular Question 3.3 years ago, created a question with more than 1,000 views. For MAKER genome annotation installation help
Popular Question 3.3 years ago, created a question with more than 1,000 views. For List of bioinformatics journal with imapact factor around 1 and no publication fee
Popular Question 3.6 years ago, created a question with more than 1,000 views. For MAKER genome annotation installation help
Popular Question 4.4 years ago, created a question with more than 1,000 views. For List of bioinformatics journal with imapact factor around 1 and no publication fee
Popular Question 4.4 years ago, created a question with more than 1,000 views. For transcription factor binding site prediction software/server
Popular Question 4.4 years ago, created a question with more than 1,000 views. For Fungal genome annotation
Popular Question 4.7 years ago, created a question with more than 1,000 views. For List of bioinformatics journal with imapact factor around 1 and no publication fee
Popular Question 4.7 years ago, created a question with more than 1,000 views. For tree obtained from neighbor-joining and maximum-likelihood are different.
Popular Question 4.7 years ago, created a question with more than 1,000 views. For tree obtained from neighbor-joining and maximum-likelihood are different.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2437 users visited in the last hour