User: Shahzad

gravatar for Shahzad
Shahzad10
Reputation:
10
Status:
New User
Location:
Pakistan
Last seen:
4 months, 4 weeks ago
Joined:
4 years, 10 months ago
Email:
s****@live.com

Posts by Shahzad

<prev • 47 results • page 1 of 5 • next >
0
votes
2
answers
374
views
2
answers
Comment: C: how to extract counts from bam/merge-bam without gtf
... how to proceed further with idxstat output. I have done it but I thing I have done any mistake DESeq did not accept it. Can you please guide about how to format the output tables for DESeq or EdgeR? ...
written 7 months ago by Shahzad10
0
votes
2
answers
374
views
2
answers
Comment: C: how to extract counts from bam/merge-bam without gtf
... thank you for guiding. reference genome is not available yet. I ll try salmon and let you know about the output. Thank you. ...
written 7 months ago by Shahzad10
3
votes
2
answers
374
views
2
answers
how to extract counts from bam/merge-bam without gtf
... I have aligned my RNA-seq PE on Transcriptome with no gtf file available using Bowtie2. Used Samtools to make bam files and sorted. Used sambamba merge to merge the sorted bam replicates and resorted using samtools. bowtie2 -x ../refrence-transcriptome -1 rep1_1.fq -2 rep1_2.fq -S sample1.sa ...
R samtools bowtie2 rna-seq hisat2 written 7 months ago by Shahzad10 • updated 7 months ago by michael.ante3.3k
0
votes
1
answer
724
views
1
answers
Comment: C: hisat2 and RSEM pipeline
... thank you for confirming. is there any suggestion about which pipeline will be appropriate. i have transcriptome.fa but no gtf file. RNAseq data from plant is paired end 4 conditions with 3 bioreps. ...
written 7 months ago by Shahzad10
0
votes
1
answer
724
views
1
answer
hisat2 and RSEM pipeline
... Hello All I am using hisat2 for alignment and RSEM for estimated counts as suggest by a previous post on this site. I need some guidance regarding 1> Does RSEM accepts hisat2 generated transcriptome indexes? 2> rsem-calculate-expression can be used alone without rsem-prepare-reference step ...
software error gtf rna-seq rsem hisat2 written 7 months ago by Shahzad10 • updated 7 months ago by EagleEye6.4k
0
votes
2
answers
2.8k
views
2
answers
Comment: C: Can I use own transcriptome without GTF file?
... thank you does RSEM accepts hisat2 index? ...
written 7 months ago by Shahzad10
0
votes
0
answers
1.8k
views
0
answers
Comment: C: Sort bam file by coordinates using samtools
... i downloaded this reference and gtf file from ensemble reference genome database. still got the same error with the upper mentioned command **too few arguments**. I previously tried different parameters but they did not worked that time too. so i went with the default settings ...
written 9 months ago by Shahzad10
0
votes
0
answers
1.8k
views
0
answers
Comment: C: Sort bam file by coordinates using samtools
... > testdata> htseq-count -f bam SRR7042071.bam -r pos -o SRR7042071.txt Sor.gtf > /home/miniconda2/lib/python2.7/site-packages/HTSeq/__init__.py:9: > RuntimeWarning: numpy.dtype size changed, may indicate binary > incompatibility. Expected 96, got 88 from _HTSeq impor ...
written 9 months ago by Shahzad10 • updated 9 months ago by WouterDeCoster39k
0
votes
0
answers
1.8k
views
0
answers
Comment: C: Sort bam file by coordinates using samtools
... SRR7042071.15979724 133 1 1687 0 * = 1687 0 CAAGCATATACCCCCCCAGCATCCATCCTCAATCAGGCAACGTTCGGGCATGCAGCAGCCATTATCATATCCATT AA---A< ...
written 9 months ago by Shahzad10 • updated 9 months ago by Sej Modha4.2k
0
votes
0
answers
1.8k
views
0
answers
Comment: C: Sort bam file by coordinates using samtools
... it gives an error when i run it with -b invalid option -- 'b' if samtools by default is set to coordinated bam output then can you please suggest any reason why the htseq is generating empty text file when i used the bam file. while when i upload same bam file with indexed bai file in igv ge ...
written 9 months ago by Shahzad10 • updated 9 months ago by finswimmer11k

Latest awards to Shahzad

Popular Question 5 months ago, created a question with more than 1,000 views. For How to get counts of STAR output (sam/bam).
Great Question 9 months ago, created a question with more than 5,000 views. For How to get counts of STAR output (sam/bam).
Great Question 21 months ago, created a question with more than 5,000 views. For FastQC not making html output report.
Popular Question 21 months ago, created a question with more than 1,000 views. For How to get counts of STAR output (sam/bam).
Popular Question 21 months ago, created a question with more than 1,000 views. For How to make an annotation file for reference genome?
Popular Question 21 months ago, created a question with more than 1,000 views. For adding sequence in ncbi downloaded blast result txt file
Popular Question 21 months ago, created a question with more than 1,000 views. For NGS microRNA (smRNA) analysis
Popular Question 21 months ago, created a question with more than 1,000 views. For Identical structure in different domains.
Popular Question 21 months ago, created a question with more than 1,000 views. For HD image drawing for research/review paper
Popular Question 21 months ago, created a question with more than 1,000 views. For FastQC not making html output report.
Popular Question 21 months ago, created a question with more than 1,000 views. For miRNA target prediction tools
Popular Question 21 months ago, created a question with more than 1,000 views. For RNA-seq reads mapping on reference genome
Popular Question 2.4 years ago, created a question with more than 1,000 views. For How to get counts of STAR output (sam/bam).
Popular Question 2.4 years ago, created a question with more than 1,000 views. For How to get counts of STAR output (sam/bam).
Popular Question 2.7 years ago, created a question with more than 1,000 views. For FastQC not making html output report.
Popular Question 3.0 years ago, created a question with more than 1,000 views. For miRNA target prediction tools

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1132 users visited in the last hour