User: bitjunkie

gravatar for bitjunkie
bitjunkie40
Reputation:
40
Status:
New User
Location:
United States
Last seen:
2 years, 1 month ago
Joined:
5 years, 3 months ago
Email:
v*****@gmail.com

Posts by bitjunkie

<prev • 13 results • page 1 of 2 • next >
1
vote
0
answers
728
views
0
answers
From sam data, how do I tell from which fastq file each read came from?
... I already know that you can use the first and second in pair information from the sam FLAG, but it works only if you have one pair of paired-read files. I need to do this for multiple pairs and/or single end reads. Any one know an efficient work around? Thanks! ...
bowtie2 sam read file origin parsing written 2.4 years ago by bitjunkie40
0
votes
0
answers
926
views
0
answers
Comment: C: bowtie2: user error or a bug?
... Same thing happens when I try to map two read pairs with -1 p1_1.fastq,p2_1.fastq -2 p1_2.fastq,p2_2.fastq 1 reads; of these: 1 (100.00%) were paired; of these: 0 (0.00%) aligned concordantly 0 times 1 (100.00%) aligned concordantly exactly 1 time 0 (0.00%) al ...
written 2.4 years ago by bitjunkie40
0
votes
0
answers
926
views
0
answers
Comment: C: bowtie2: user error or a bug?
... Tired the second one to the same effect. However, the first one did report the three reads. Interesting. Error in parameter parsing perhaps? ...
written 2.4 years ago by bitjunkie40
0
votes
0
answers
926
views
0
answers
bowtie2: user error or a bug?
... I have a fastq file A.fastq $ - cat A.fastq @M04260:125:000000000-B9R94:1:1101:14837:1590 1:N:0:46 CGGCATTGACTGACAGCCTAGCATTTAAACGAGATTGTTTAAACAAAGATAAGG + 111>1AF11BD1AA11AAG1EG1GHHFBBA0000FGFGHHDBDFFA000FD111 @M04260:125:000000000-B9R94:1:1101:17735:1640 1:N:0:46 T ...
unpaired bowtie2 multiple files written 2.4 years ago by bitjunkie40
0
votes
1
answer
1.7k
views
1
answers
Comment: A: Is there a genbank format validator out there?
... Thanks Chris. The feature table is what I'm interested in -- I don't care about the rest of the file. Edited my question as such. ...
written 4.1 years ago by bitjunkie40 • updated 18 days ago by RamRS25k
1
vote
1
answer
1.7k
views
1
answer
Is there a genbank format validator out there?
... Does anyone have a script that can validate the feature table in genbank files against the format specification by INSDC found here?  Also, I only need it for bacterial genomes, plasmids. ...
format genbank written 4.1 years ago by bitjunkie40
2
votes
2
answers
1.9k
views
2
answers
Non-uniform illumina coverage, why?
... Hello everyone, I have some new Illumina datasets that show non-uniform coverage (last image). My older datasets have uniform coverage across the whole genome (first image).  I don't know what library method was used for the first image, but for the second I am pretty sure it was the nextera kit. I ...
genome latest next-gen sequencing written 4.3 years ago by bitjunkie40 • updated 22 months ago by Biostar ♦♦ 20
5
votes
2
answers
1.2k
views
2
answers
Is this contig for real? Getting support from bowtie2 mappings
... Hey guys, So, I have some contigs constructed from illumina paired-reads (with ABySS) that did not map to our reference genomic sequence, which was supposed to be the only thing in our sample. About half the reads did not map and we sequenced to a high depth. I want to find out which of these conti ...
assembly alignment sequencing written 5.2 years ago by bitjunkie40 • updated 5.2 years ago by Philipp Bayer6.5k
0
votes
1
answer
1.5k
views
1
answers
Comment: C: How to generate mapping information in SAM format
... Ah I see. Looks like I have to do a little reading regarding bedtools, bed format, and SAM format. Thanks people. ...
written 5.3 years ago by bitjunkie40
0
votes
1
answer
1.5k
views
1
answers
Comment: C: How to generate mapping information in SAM format
... I don't have a feature file? Are you talking about genome feature files (.gff)? Can I use this method if my information is equivalent to "x read maps to y location with z mismatches"?   ...
written 5.3 years ago by bitjunkie40

Latest awards to bitjunkie

Popular Question 2.8 years ago, created a question with more than 1,000 views. For fastq file question

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 903 users visited in the last hour