User: eyb

gravatar for eyb
Russian Federation
Last seen:
2 years, 1 month ago
4 years, 6 months ago

Posts by eyb

<prev • 47 results • page 1 of 5 • next >
What is the easiest way to add gene annotation on X axis?
... I have calculated statistics for snps using selscan and some other software. > pos gpos p1 ihh1 p2 ihh2 xpehh normxpehh > rs13303118 918384 2.48676 0.407895 0.111293 0.540404 0.119766 -0.0733738 -0.566022 > rs2341354 918573 2.48727 0.302632 0.118606 0.565657 0.121548 -0.024507 ...
plotting annotation snp written 2.3 years ago by eyb180
Comment: C: Do I have to look for sequence or reverse complement?
... I've searched for reverse compliment of antisense primer, but it does not find anything. ...
written 2.3 years ago by eyb180
Comment: C: Do I have to look for sequence or reverse complement?
... In [86]: dna = Seq("GCTAACCTCTCTGGACCACCTTC") In [87]: dna.reverse_complement Out[87]: In [88]: dna.reverse_complement() Out[88]: Seq('GAAGGTGGTCCAGAGAGGTTAGC', Alphabet()) In [90]: yak_2.seq.find(dna.reverse_complement()) Out[90]: -1 ...
written 2.3 years ago by eyb180
Do I have to look for sequence or reverse complement?
... I have a gene reference sequence I downloaded from NCBI: I've read a paper and wanted to do a little sanity check mostly for educational purposes. Basically I want to find primers in a reference sequence. The primers are for example: ...
sequence biopython written 2.3 years ago by eyb180 • updated 2.3 years ago by william.bill.langdon30
How to standardize iHS, NSL and XP-EHH scores
... I have calculated a bunch of scores for my data using **selscan** software. How do I standardize the results? At the moment I am using the following Python line: `-np.log10(st.mstats.zscore(t[7]))` Am I doing this right? Description of the function zscore: Calculates the z score of each value in ...
selection snp written 2.6 years ago by eyb180 • updated 2.6 years ago by patel.ravip50
Comment: C: Sequence alignment in biopython
... Thanks. Links did not attach. Can you please edit your post? EDIT it's ok now ...
written 2.8 years ago by eyb180
Sequence alignment in biopython
... I have a bunch of 500-600 bp sequences which I want to align. My goal is to get one file where all sequences would be aligned to the reference mitochondrial [sequence][1]. How do I do that using biopython? I figured out how to read, slice and dice, but I couldn't figure out how to make sth or aln (I ...
sequence biopython written 2.8 years ago by eyb180 • updated 2.7 years ago by Biostar ♦♦ 20
Comment: C: How to interpret XPEHH (recent selection) score?
... Thanks. I will try to calculate p-values this way. ...
written 3.2 years ago by eyb180
How to interpret XPEHH (recent selection) score?
... I have calculated XP-EHH and iHS scores for a set of snps using selscan. XP-EHH ranges from -0.75 to 0.9. What do extreme values show? In the original publication they plot log(P-value). I think that P-values was calculated to show differences between xp-ehh and iHS. Does anyone have experience with ...
selscan selection written 3.3 years ago by eyb180 • updated 3.3 years ago by Giovanni M Dall'Olio26k
Is it better to phase two populations together or separately?
... I have two populations which I need to phase for further analysis. The question is is it better to phase them separately or together? Can anyone explain why? ...
populations phasing beagle written 3.4 years ago by eyb180 • updated 3.3 years ago by Giovanni M Dall'Olio26k

Latest awards to eyb

Supporter 2.2 years ago, voted at least 25 times.
Popular Question 2.6 years ago, created a question with more than 1,000 views. For bam file assembly (1000 genomes)
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Is there a way to phase an unphased data for selection detection?
Popular Question 3.1 years ago, created a question with more than 1,000 views. For Selection detection software
Popular Question 3.7 years ago, created a question with more than 1,000 views. For Selection detection software


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1083 users visited in the last hour