User: eyb

gravatar for eyb
eyb180
Reputation:
180
Status:
Trusted
Location:
Russian Federation
Last seen:
21 hours ago
Joined:
5 years, 12 months ago
Email:
a*********@gmail.com

Posts by eyb

<prev • 50 results • page 1 of 5 • next >
0
votes
0
answers
43
views
0
answers
Comment: C: How to extract a subset of samples from plink .bed files
... Thanks, but at the top of the fam file are IDs that I already extracted. IDs that I need are somewhere in the middle. ...
written 2 days ago by eyb180
0
votes
0
answers
43
views
0
answers
Comment: C: How to extract a subset of samples from plink .bed files
... Here is the plink log from problematic run. PLINK v1.90b6.18 32-bit (16 Jun 2020) Options in effect: --bed study.bed --bim study.bim --fam study.fam --keep-fam controls_ii.txt --make-bed --out controls_ii Hostname: aydar-XPS-13-9360 Working directory: /hom ...
written 2 days ago by eyb180
0
votes
0
answers
43
views
0
answers
How to extract a subset of samples from plink .bed files
... Hello. I am trying to extract data from .bed file using the following command: ./plink_linux_i686_20200616/plink --bed study.bed --bim study.bim --fam study.fam --keep-fam ii.txt --make-bed --out ii It works for affected samples, but when I try to do the same for controls it says that there are ...
bed plink ped written 2 days ago by eyb180
0
votes
0
answers
994
views
0
answers
What is the easiest way to add gene annotation on X axis?
... I have calculated statistics for snps using selscan and some other software. > pos gpos p1 ihh1 p2 ihh2 xpehh normxpehh > rs13303118 918384 2.48676 0.407895 0.111293 0.540404 0.119766 -0.0733738 -0.566022 > rs2341354 918573 2.48727 0.302632 0.118606 0.565657 0.121548 -0.024507 ...
plotting annotation snp written 3.8 years ago by eyb180
0
votes
1
answer
1.6k
views
1
answers
Comment: C: Do I have to look for sequence or reverse complement?
... I've searched for reverse compliment of antisense primer, but it does not find anything. ...
written 3.8 years ago by eyb180
0
votes
1
answer
1.6k
views
1
answers
Comment: C: Do I have to look for sequence or reverse complement?
... In [86]: dna = Seq("GCTAACCTCTCTGGACCACCTTC") In [87]: dna.reverse_complement Out[87]: In [88]: dna.reverse_complement() Out[88]: Seq('GAAGGTGGTCCAGAGAGGTTAGC', Alphabet()) In [90]: yak_2.seq.find(dna.reverse_complement()) Out[90]: -1 ...
written 3.8 years ago by eyb180
2
votes
1
answer
1.6k
views
1
answer
Do I have to look for sequence or reverse complement?
... I have a gene reference sequence I downloaded from NCBI: https://www.ncbi.nlm.nih.gov/gene/102267223#reference-sequences I've read a paper and wanted to do a little sanity check mostly for educational purposes. Basically I want to find primers in a reference sequence. The primers are for example: ...
sequence biopython written 3.8 years ago by eyb180 • updated 3.8 years ago by william.bill.langdon30
4
votes
1
answer
2.3k
views
1
answer
How to standardize iHS, NSL and XP-EHH scores
... I have calculated a bunch of scores for my data using **selscan** software. How do I standardize the results? At the moment I am using the following Python line: `-np.log10(st.mstats.zscore(t[7]))` Am I doing this right? Description of the function zscore: Calculates the z score of each value in ...
selection snp written 4.0 years ago by eyb180 • updated 4.0 years ago by patel.ravip60
1
vote
0
answers
2.9k
views
0
answers
Comment: C: Sequence alignment in biopython
... Thanks. Links did not attach. Can you please edit your post? EDIT it's ok now ...
written 4.3 years ago by eyb180
5
votes
0
answers
2.9k
views
0
answers
Sequence alignment in biopython
... I have a bunch of 500-600 bp sequences which I want to align. My goal is to get one file where all sequences would be aligned to the reference mitochondrial [sequence][1]. How do I do that using biopython? I figured out how to read, slice and dice, but I couldn't figure out how to make sth or aln (I ...
sequence biopython written 4.3 years ago by eyb180 • updated 4.2 years ago by Biostar ♦♦ 20

Latest awards to eyb

Great Question 3.6 years ago, created a question with more than 5,000 views. For How to interpret XPEHH (recent selection) score?
Popular Question 3.6 years ago, created a question with more than 1,000 views. For ped to HGDP format conversion
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Genome STRiP execution time
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Is there a way to phase an unphased data for selection detection?
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Is it better to phase two populations together or separately?
Popular Question 3.6 years ago, created a question with more than 1,000 views. For How to create reference allele file in plink? (~50 SNPs)
Popular Question 3.6 years ago, created a question with more than 1,000 views. For How to standardize iHS, NSL and XP-EHH scores
Popular Question 3.6 years ago, created a question with more than 1,000 views. For How to match filenames in different directories?(bash or python)
Popular Question 3.6 years ago, created a question with more than 1,000 views. For How does SNP position numeration work?
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Sequence alignment in biopython
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Selection detection software
Popular Question 3.6 years ago, created a question with more than 1,000 views. For bam file assembly (1000 genomes)
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Do I have to look for sequence or reverse complement?
Student 3.6 years ago, asked a question with at least 3 up-votes. For Selection detection software
Student 3.6 years ago, asked a question with at least 3 up-votes. For How to interpret XPEHH (recent selection) score?
Supporter 3.7 years ago, voted at least 25 times.
Popular Question 4.0 years ago, created a question with more than 1,000 views. For bam file assembly (1000 genomes)
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Is there a way to phase an unphased data for selection detection?
Popular Question 4.6 years ago, created a question with more than 1,000 views. For Selection detection software
Popular Question 5.2 years ago, created a question with more than 1,000 views. For Selection detection software

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 675 users visited in the last hour