User: Tori

gravatar for Tori
Tori90
Reputation:
90
Status:
Trusted
Location:
Finland
Last seen:
1 year, 9 months ago
Joined:
5 years ago
Email:
b*****@live.com

Posts by Tori

<prev • 24 results • page 1 of 3 • next >
0
votes
0
answers
552
views
0
answers
How to get overlap count (in basepair) of two IRange objects?
... I have following two IRanges objects query and ref. I would like to get overlap in number of basepairs. > ref chr start end 1 1 120 190 2 1 910 1050 3 1 1100 1140 4 1 2550 2650 5 2 50 100 > query chr start end 1 1 101 173 ...
iranges R written 22 months ago by Tori90
0
votes
1
answer
1.1k
views
1
answers
Comment: C: How to create genomic windows in R?
... What if `df` has not only chr7 in first column? ...
written 2.8 years ago by Tori90
0
votes
1
answer
1.1k
views
1
answers
Comment: C: How to create genomic windows in R?
... Thank you very much! ...
written 2.8 years ago by Tori90
2
votes
1
answer
1.1k
views
1
answer
How to create genomic windows in R?
... I have methylation data which looks like this for example. chr start end meth chr7 31441 31441 0.16542433 chr7 31467 31467 0.93508003 chr7 50060 50060 0.38091076 chr7 50097 50097 0.31270269 chr7 50147 50147 0.39961491 chr7 50158 50158 0.01449239 chr ...
R dnamethylation written 2.8 years ago by Tori90 • updated 2.8 years ago by andrew.j.skelton735.9k
0
votes
1
answer
1.7k
views
1
answers
Comment: C: Do I have to use beta-values/m-values for RRBS/WGBS data ?
... I have used Methylkit, RnBeads and RadMeth for analysing RRBS data, but after diving into greater detail of the result files of these methods DM regions with high p-value/qvalue does not make sense. Those statistically significant (high p-value/qvalue) DM regions do not seem significant in biologic ...
written 2.8 years ago by Tori90
2
votes
1
answer
1.7k
views
1
answer
Do I have to use beta-values/m-values for RRBS/WGBS data ?
... I am working on RRBS data. Someone suggested me to use M-values for the calculation of differential methylation. In my understanding beta-values/m-values are used to measure methylation level in array based method. In sequencing data we get single base pair resolution methylation level after methyla ...
methylation rrbs wgbs written 2.8 years ago by Tori90 • updated 2.8 years ago by Devon Ryan93k
1
vote
1
answer
1.1k
views
1
answer
How can I get gene annotations for hg38 in R?
... How can I get table like following in R for hg38? RefseqID Symbol Description EntrezID NM_000014 A2M alpha-2-macroglobulin 2 NM_000015 NAT2 N-acetyltransferase 2 (arylamine N-acetyltransferase) 10 NM_000016 ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain 34 NM_000017 AC ...
annotation hg38 R written 3.0 years ago by Tori90 • updated 3.0 years ago by WouterDeCoster42k
0
votes
0
answers
2.2k
views
0
answers
Conversion effinciency issue in whole genome bisulfite sequencing data.
... I have samples from Whole Genome Bisulfite Sequencing. Lambda genome has been spiked-in. I calculate bisulfite conversion efficiency by mapping the data to lambda genome and calculate conversion efficiency using following equation. Conversion efficiency = 100 - {no. of methylated Cs in CpG context/ ...
wgbs conversion-efficiency bismark written 4.0 years ago by Tori90 • updated 4.0 years ago by Giovanni M Dall'Olio26k
0
votes
1
answer
2.2k
views
1
answers
Comment: C: How can I identify which read is optical duplicate in SAM file?
... @Pierre Lindenbaum Thanks for your informative comment. So, PCR duplicates and optical duplicates can not be identified from BAM/SAM file because both have same flag 1024. If I plot x and y coordinates I can possibly see in the plot the location of the duplicates. If there are points very close to o ...
written 4.1 years ago by Tori90 • updated 5 days ago by RamRS25k
0
votes
1
answer
2.2k
views
1
answers
Comment: C: How can I identify which read is optical duplicate in SAM file?
... One of the reads from SAM file looks likes this J00117:26:H3YC3BBXX:5:1224:28384:20918 419 chr1 12734 3 101M = 12855 222 TAGACAGTGAGTGGGAGTGGCGTCGCCCCTAGGGCTCTACGGGGCCGGCATCTCCTGTCTCCTGGAGAGGCTTCGATGCCCCTCCACACCCTCTTGATCTT AAFFFKKFKKKAFKKKKKKKKKKFKKKKKKKKKKKKFKKKKK ...
written 4.1 years ago by Tori90

Latest awards to Tori

Popular Question 2.7 years ago, created a question with more than 1,000 views. For How can I calculate bisulfite conversion rate from RRBS data?
Popular Question 2.7 years ago, created a question with more than 1,000 views. For How to caclulate ChIP-Seq coverage?
Popular Question 2.7 years ago, created a question with more than 1,000 views. For Why 50bp Illumina run produces 51bp long sequencs?
Popular Question 3.0 years ago, created a question with more than 1,000 views. For How can I calculate bisulfite conversion rate from RRBS data?
Student 3.0 years ago, asked a question with at least 3 up-votes. For Why 50bp Illumina run produces 51bp long sequencs?
Popular Question 4.0 years ago, created a question with more than 1,000 views. For How can I calculate bisulfite conversion rate from RRBS data?
Popular Question 4.0 years ago, created a question with more than 1,000 views. For How to caclulate ChIP-Seq coverage?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 873 users visited in the last hour