User: Peter

gravatar for Peter
Peter0
Reputation:
0
Status:
New User
Last seen:
2 weeks, 6 days ago
Joined:
2 years, 9 months ago
Email:
j*********@163.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Peter

<prev • 10 results • page 1 of 1 • next >
0
votes
0
answers
109
views
0
answers
Which softwares do you suggest to analysis CNV with Human660W-Quad_v1_H sap array?
... I have paired tumor samples data from Human660W-Quad_v1_H sap array. I want to detect CNV based on these data. Which softwares do you suggest to analysis CNV with Human660W-Quad_v1_H sap array? ...
660w snp array cnv human660w-quad_v1_h written 4 weeks ago by Peter0
1
vote
1
answer
410
views
1
answer
Get all gene symbol in kegg pathway with clusterProfiler
... How can we get all genes in a Pathway with clusterProfiler? eg, kegg pathway: hsa04151. Thank you very much in advance. ...
clusterprofiler written 8 months ago by Peter0 • updated 8 months ago by Guangchuang Yu1.6k
0
votes
1
answer
1.1k
views
1
answers
Comment: C: BreakDancer make error
... It works well on Ubuntu system. But not Centos 6.4 system.   ...
written 2.5 years ago by Peter0
0
votes
1
answer
1.1k
views
1
answers
Answer: A: BreakDancer make error
... ~/bin/breakdancer/build$cmake .. -DCMAKE_BUILD_TYPE=release -DCMAKE_INSTALL_PREFIX=/usr/local -- The C compiler identification is GNU 4.8.2 -- The CXX compiler identification is GNU 4.8.2 -- Check for working C compiler: /usr/bin/cc -- Check for working C compiler: /usr/bin/cc -- works -- Detecting ...
written 2.5 years ago by Peter0
1
vote
1
answer
895
views
1
answer
Breakdancer: bam2cfg.pl error
... breakdancer version: 1.4.5   ${breakdancer}/bam2cfg.pl -g -h ${datindir}/${case} ${datindir}/${control} > output/${s}.cfg   Use of uninitialized value $lib in hash element at bam2cfg.pl line 79, <$bam> line 27. ...
breakdancer written 2.5 years ago by Peter0 • updated 2.5 years ago by ernfrid180
0
votes
1
answer
1.1k
views
1
answer
BreakDancer make error
... ~/bin/breakdancer/build$make [ 14%] Built target boost-libs [ 28%] Built target samtools-lib [ 28%] Built target deps [ 42%] Built target gtest160 [ 49%] Built target breakdancer [ 52%] Built target common [ 71%] Built target io Linking CXX executable ../../../../bin/breakdancer-max ../../../../vend ...
breakdancer written 2.5 years ago by Peter0
0
votes
2
answers
2.1k
views
2
answers
Comment: C: De novo assembly for virus genome with Velvet.
... Why here is not the deeper the better? The reference genome is about 3000bp. Which is better for 2*300bp or 2*100bp or 1*300bp? ...
written 2.8 years ago by Peter0
0
votes
2
answers
2.1k
views
2
answers
Comment: C: De novo assembly for virus genome with Velvet.
... Here is my reference. >2547-16_ASC_B CTCCACCACTTTCCACCAAACTCTTCAAGATCCCAGAGTCAGGGCCCTGTACTTTCCTGCTGGTGGCTCCAGTTCAGGAACAGTGAGCCCTGCTCAGAATACTGTCTCTGCCATATCGTCAATCTTATCGAAGACTGGGGACCCTGTACCGAACATGGAGAACATCGCATCAGGACTCCTAGGACCCCTGCTCGTGTTACAGGCGGGGTTTTTCTTGTTGACAAAAATCCTCACAATACCACAGAGTCTAGACTCGTGG ...
written 2.8 years ago by Peter0
0
votes
2
answers
2.1k
views
2
answers
Comment: C: De novo assembly for virus genome with Velvet.
... My input data is 100bp paired end. I simulate the data with wgsim. The data quality is fine on the data. ...
written 2.8 years ago by Peter0
0
votes
2
answers
2.1k
views
2
answers
De novo assembly for virus genome with Velvet.
... Dear expert, I want to assembly a virus genome using velvet. The virus genome is about 3KB length. In the follow command, ref1.fa is the reference genome. But it seems that I can not success. I cannot get back ref1.fa from the simulate reads. ~/bin/bioinfomatics/wgsim-master/wgsim -N 500000 -1 100 ...
assembly velvet written 2.8 years ago by Peter0 • updated 2.8 years ago by rtliu2.0k

Latest awards to Peter

Popular Question 7 months ago, created a question with more than 1,000 views. For BreakDancer make error
Popular Question 2.2 years ago, created a question with more than 1,000 views. For De novo assembly for virus genome with Velvet.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1211 users visited in the last hour