User: skbrimer

gravatar for skbrimer
skbrimer340
Reputation:
340
Status:
Trusted
Location:
United States
Last seen:
1 month ago
Joined:
2 years, 4 months ago
Email:
s*******@gmail.com

Posts by skbrimer

<prev • 135 results • page 1 of 14 • next >
0
votes
1
answer
212
views
1
answers
Answer: A: Group a set of plots using MUMmer
... It looks like it is actually 6 MUMer plots. The paper says they took their 6 largest contigs and mapped it against the 6 D.melanogaster chromosomal arms. I do not know anything about the fruit fly genome so I do not know if you need to make a multi-fasta of all the arms or not, but you would only ma ...
written 3 months ago by skbrimer340
1
vote
1
answer
249
views
1
answers
Comment: C: Calling Qiime scripts sequencially in Python 2.7 program
... last one :) picker = Popen ([pick_open_reference_otus.py, -i, allseq_file, -r, refseq_file, -o, noName, -s, 0.1, -m, usearch61, -p, param_file ], shell = True) picker.wait() picker_out = os.path.join(path, "otu_output/otu_table_mc2_w_tax.biom") ...
written 4 months ago by skbrimer340
1
vote
1
answer
249
views
1
answers
Comment: C: Calling Qiime scripts sequencially in Python 2.7 program
... or ` picker_out = picker.wait(os.path.join(path, "otu_output/otu_table_mc2_w_tax.biom")` sorry. I'm not sure about the syntax ...
written 4 months ago by skbrimer340
1
vote
1
answer
249
views
1
answers
Comment: C: Calling Qiime scripts sequencially in Python 2.7 program
... I'm not 100% sure because I have not done any work with the subprocesses module, however I think you can just use the wait() module. something like `picker.wait(picker_out)` or something to that effect. ...
written 4 months ago by skbrimer340
1
vote
1
answer
336
views
1
answers
Comment: C: Error while running BWA
... Sorry, time changes. If you still need it. The code should look like this. From Bio import SeqIO For seq in SeqIO.parsre("in.fasta", "fasta", "out.fasta", "fasta") You can either use it in Python itself or write a quick script to accept the input from the command line. ...
written 4 months ago by skbrimer340
0
votes
1
answer
336
views
1
answers
Answer: A: Error while running BWA
... The error is most likely due to the data index being formated incorrectly. In the past I have used Biopython to fix white space issues with fast files. You can use the SeqIO.convert function and "convert" it to fasta again. The function will format the fasta correctly and it should resolve the issu ...
written 4 months ago by skbrimer340
0
votes
0
answers
207
views
0
answers
Comment: C: SOLVED:Multiple aligner failures but no error(Closed)
... Also for the record :) It works so much better with something to actual align. ------------------ Results ------------------ Genome: 1 Key Length: 13 Max Indel: 16000 Minimum Score Ratio: 0.56 Mapping Mode: ...
written 4 months ago by skbrimer340
0
votes
0
answers
207
views
0
answers
Comment: C: Multiple aligner failures but no error
... You both are correct. It is fine. I apparently have a truncated genome file. The genbank summary file is 4.0KB in size The genbank full (truncated) I was using is 3.4MB in size the genbank full (I just reloaded) is 11.4MB Right now mapping seems to be moving along just fine with the correct file ...
written 4 months ago by skbrimer340
0
votes
0
answers
207
views
0
answers
Comment: C: Multiple aligner failures but no error
... it is unmapped bam, but in fastq it looks like this @YE0QL:00664:05761 TGAAAGCGAGCTATGTACTGAATACCGCAGAACTGCACGCGCCGCTGCAGAAAAACCAGGTGGTCGGCACCATCAACTTCCAGCTGGACGGTAAAACCATCGAGCAGCGTCCGCTGGTCGTAGACTGCGAAGAGATCCCGGGAAGGGAACTTCTTCGGTAAAATCATTGATTACATTAAATTAATGTTCCATCACTGGTTTGGATAAAATTGAACTCTTG ...
written 4 months ago by skbrimer340 • updated 4 months ago by genomax226k
0
votes
0
answers
207
views
0
answers
Comment: C: Multiple aligner failures but no error
... ----------------- Results ------------------ Genome: 1 Key Length: 13 Max Indel: 16000 Minimum Score Ratio: 0.56 Mapping Mode: normal Reads Used: 3004412 (563086674 bases) Mapping: ...
written 4 months ago by skbrimer340 • updated 4 months ago by genomax226k

Latest awards to skbrimer

Popular Question 3 months ago, created a question with more than 1,000 views. For Can Q10 be better than Q30
Centurion 10 months ago, created 100 posts.
Scholar 12 months ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Scholar 13 months ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Scholar 13 months ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Scholar 13 months ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Scholar 15 months ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Scholar 15 months ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Scholar 15 months ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Supporter 17 months ago, voted at least 25 times.
Teacher 18 months ago, created an answer with at least 3 up-votes. For A: Thrown Into A Bioinformatics Position
Scholar 22 months ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Scholar 23 months ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Scholar 23 months ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Scholar 2.1 years ago, created an answer that has been accepted. For A: Submitting several BLAST queries using NCBIWWW at once
Popular Question 2.4 years ago, created a question with more than 1,000 views. For Using Biopython and BLAST+ to automate de novo viral contig sorting

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 918 users visited in the last hour